[ { "id": "authors:kn6ta-qhx02", "collection": "authors", "collection_id": "kn6ta-qhx02", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20200427-123125281", "type": "article", "title": "Postsynaptic Mechanisms Are Essential for Forskolin-Induced Potentiation of Synaptic Transmission", "author": [ { "family_name": "Sokolova", "given_name": "Irina V.", "clpid": "Sokolova-I-V" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "It has been demonstrated that stimulation of protein kinase A (PKA) results in enhanced synaptic transmission in the hippocampus and other brain areas. To investigate mechanisms of the PKA-mediated potentiation of synaptic transmission, we used rat hippocampal embryonic cultures. In low-density cultures, paired recordings under the perforated patch demonstrated that 15-min forskolin treatment produced long-lasting potentiation of evoked excitatory postsynaptic currents (eEPSCs) mediated by the cAMP/PKA pathway. eEPSC amplitudes increased to 240 \u00b1 10% of baseline after 15 min of forskolin treatment (early). After forskolin washout, eEPSCs declined to a potentiated level. Potentiation was sustained for \u226585 min after forskolin washout and, 60 min after forskolin washout, constituted 152 \u00b1 7% of baseline (late potentiation). Disruption of presynaptic processes with the whole cell configuration and internal solution containing PKA inhibitor peptide did not affect forskolin-induced potentiation. Disruption of postsynaptic processes, in contrast, impaired early potentiation and abolished late potentiation. Study of mEPSCs confirmed the contribution of postsynaptic mechanisms. Forskolin-induced enhancement of mEPSC frequency observed under the perforated patch was attenuated by the whole cell configuration. Forskolin also induced an increase of mEPSC amplitudes in the perforated patch, but not in the whole cell, experiments. Potentiation of eEPSCs was not activity dependent, persisting in the absence of stimulation. NMDA receptor blockade did not abolish forskolin-induced potentiation. In summary, we demonstrate that forskolin-induced potentiation of eEPSCs was mediated by postsynaptic mechanisms, presumably by upregulation of AMPA receptors by phosphorylation.", "doi": "10.1152/jn.00617.2005", "issn": "0022-3077", "publisher": "American Physiological Society", "publication": "Journal of Neurophysiology", "publication_date": "2006-04", "series_number": "4", "volume": "95", "issue": "4", "pages": "2570-2579" }, { "id": "authors:84dmg-8pw63", "collection": "authors", "collection_id": "84dmg-8pw63", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20200515-112555466", "type": "article", "title": "Requirement of a critical period of GABAergic receptor blockade for induction of a cAMP-mediated long-term depression at CA3-CA1 synapses", "author": [ { "family_name": "Yu", "given_name": "Tzu-ping", "clpid": "Yu-Tzu-ping" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Previous reports show that bath application of the adenosine 3\u2032 : 5\u2032\u2010cyclic monophosphate (cAMP) analog, Sp\u2010cAMPS, induces a protein kinase A (PKA)\u2010dependent and protein synthesis\u2010dependent long\u2010term potentiation (LTP) at hippocampal CA3\u2010CA1 synapses. Recently, we reported a novel form of long\u2010term depression (LTD) induced by concurrent application of Sp\u2010cAMPS and picrotoxin, the \u03b3\u2010aminobutyric acid type A (GABA_A) receptor antagonist. In the present study, we further investigated the mechanisms underlying such cAMP\u2010mediated LTD. Synaptically connected CA3 and CA1 cells of hippocampal slice cultures were impaled by sharp electrodes. Excitatory postsynaptic potentials recorded from a CA1 pyramidal cell were evoked by single action potentials in a CA3 cell. Picrotoxin was applied to slices at various time points after Sp\u2010cAMPS was perfused. We found that Sp\u2010cAMPS\u2010induced potentiation could be converted to depression when picrotoxin was applied within 30 min after perfusion of Sp\u2010cAMPS. Picrotoxin applied 1 h after perfusion of Sp\u2010cAMPS had no effect on Sp\u2010cAMPS\u2010induced synaptic potentiation. Once LTP was induced by Sp\u2010cAMPS and expressed for 1 h, the subsequent application of Sp\u2010cAMPS and picrotoxin produced no new changes in synaptic strength. Also, once LTD was induced and expressed for 1 h, subsequent Sp\u2010cAMPS produced no new changes in synaptic strength. These findings suggest that a synapse is committed irreversibly to cAMP\u2010mediated LTP or LTD during a critical period and that later signals cannot interconvert these two fates.", "doi": "10.1002/syn.10207", "issn": "0887-4476", "publisher": "Wiley", "publication": "Synapse", "publication_date": "2003-07", "series_number": "1", "volume": "49", "issue": "1", "pages": "12-19" }, { "id": "authors:m3gnb-tp657", "collection": "authors", "collection_id": "m3gnb-tp657", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20190930-133756603", "type": "article", "title": "Number, Density, and Surface/Cytoplasmic Distribution of GABA Transporters at Presynaptic Structures of Knock-In Mice Carrying GABA Transporter Subtype 1\u2013Green Fluorescent Protein Fusions", "author": [ { "family_name": "Chiu", "given_name": "Chi-Sung", "clpid": "Chiu-Chi-Sung" }, { "family_name": "Jensen", "given_name": "Kimmo", "clpid": "Jensen-Kimmo" }, { "family_name": "Sokolova", "given_name": "Irina", "clpid": "Sokolova-Irina" }, { "family_name": "Wang", "given_name": "Dan", "clpid": "Wang-Daniel" }, { "family_name": "Li", "given_name": "Ming", "clpid": "Li-Ming" }, { "family_name": "Deshpande", "given_name": "Purnima", "clpid": "Deshpande-Purnima" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Mody", "given_name": "Istvan", "clpid": "Mody-Istvan" }, { "family_name": "Quick", "given_name": "Michael W.", "clpid": "Quick-Michael-W" }, { "family_name": "Quake", "given_name": "Stephen R.", "clpid": "Quake-S-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "GABA transporter subtype 1 (GAT1) molecules were counted near GABAergic synapses, to a resolution of \u223c0.5 \u03bcm. Fusions between GAT1 and green fluorescent protein (GFP) were tested in heterologous expression systems, and a construct was selected that shows function, expression level, and trafficking similar to that of wild-type (WT) GAT1. A strain of knock-in mice was constructed that expresses this mGAT1\u2013GFP fusion in place of the WT GAT1 gene. The pattern of fluorescence in brain slices agreed with previous immunocytochemical observations. [^3H]GABA uptake, synaptic electrophysiology, and subcellular localization of the mGAT1\u2013GFP construct were also compared with WT mice. Quantitative fluorescence microscopy was used to measure the density of mGAT1\u2013GFP at presynaptic structures in CNS preparations from the knock-in mice. Fluorescence measurements were calibrated with transparent beads and gels that have known GFP densities. Surface biotinylation defined the fraction of transporters on the surface versus those in the nearby cytoplasm. The data show that the presynaptic boutons of GABAergic interneurons in cerebellum and hippocampus have a membrane density of 800\u20131300 GAT1 molecules per square micrometer, and the axons that connect boutons have a linear density of 640 GAT1 molecules per micrometer. A cerebellar basket cell bouton, a pinceau surrounding a Purkinje cell axon, and a cortical chandelier cell cartridge carry 9000, 7.8 million, and 430,000 GAT1 molecules, respectively; 61\u201363% of these molecules are on the surface membrane. In cultures from hippocampus, the set of fluorescent cells equals the set of GABAergic interneurons. Knock-in mice carrying GFP fusions of membrane proteins provide quantitative data required for understanding the details of synaptic transmission in living neurons.", "doi": "10.1523/jneurosci.22-23-10251.2002", "pmcid": "PMC6758747", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "2002-12-01", "series_number": "23", "volume": "22", "issue": "23", "pages": "10251-10266" }, { "id": "authors:q45bq-nt875", "collection": "authors", "collection_id": "q45bq-nt875", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20150303-122051974", "type": "article", "title": "Selective Electrical Silencing of Mammalian Neurons In Vitro by the Use of Invertebrate Ligand-Gated Chloride Channels", "author": [ { "family_name": "Slimko", "given_name": "Eric M.", "clpid": "Slimko-Eric-M" }, { "family_name": "McKinney", "given_name": "Sheri", "clpid": "McKinney-Sheri-L" }, { "family_name": "Anderson", "given_name": "David J.", "orcid": "0000-0001-6175-3872", "clpid": "Anderson-D-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Selectively reducing the excitability of specific neurons will (1) allow for the creation of animal models of human neurological disorders and (2) provide insight into the global function of specific sets of neurons. We focus on a combined genetic and pharmacological approach to silence neurons electrically. We express invertebrate ivermectin (IVM)-sensitive chloride channels (Caenorhabditis elegans GluCl \u03b1 and \u03b2) with a Sindbis virus and then activate these channels with IVM to produce inhibition via a Cl^\u2212 conductance. We constructed a three-cistron Sindbis virus that expresses the \u03b1 and \u03b2 subunits of a glutamate-gated chloride channel (GluCl) along with the green fluorescent protein (EGFP) marker. Expression of the C. elegans channel does not affect the normal spike activity or GABA/glutamate postsynaptic currents of cultured embryonic day 18 hippocampal neurons. At concentrations as low as 5 nM, IVM activates a Cl^\u2212 current large enough to silence infected neurons effectively. This conductance reverses in 8 hr. These low concentrations of IVM do not potentiate GABA responses. Comparable results are observed with plasmid transfection of yellow fluorescent protein-tagged (EYFP) GluCl \u03b1 and cyan fluorescent protein-tagged (ECFP) GluCl \u03b2. The present study provides an in vitromodel mimicking conditions that can be obtained in transgenic mice and in viral-mediated gene therapy. These experiments demonstrate the feasibility of using invertebrate ligand-activated Cl^\u2212 channels as an approach to modulate excitability.", "doi": "10.1523/JNEUROSCI.22-17-07373.2002", "pmcid": "PMC6757961", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "2002-09-01", "series_number": "17", "volume": "22", "issue": "17", "pages": "7373-7379" }, { "id": "authors:fs7zk-yva70", "collection": "authors", "collection_id": "fs7zk-yva70", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:DAVarb02", "type": "article", "title": "My career in molecular biology", "author": [ { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Norman Davidson's training as a physical chemist led him to make key early contributions to the chemistry of DNA. He described the details of DNA denaturation and renaturation, concepts that still form the basis for understanding hybridization. He also applied the single-molecule resolution of the electron microscope to describing the chemistry of circular DNA, mapping specific genes, and characterizing heteroduplexes. The latter became a dominant tool for the study of nucleic acids and contributed to our knowledge of transcription, polyadenylation, and retroviral structure. The advent of cDNA cloning and restriction enzymes enabled Davidson to describe the diversity of Drosophila actin genes and to isolate the gene encoding cAMP phosphodiesterase. Davidson then turned his attention to neuroscience and participated in cDNA cloning, oocyte expression, and structure-function studies of nicotinic acetylcholine receptors, voltage-gated sodium channels, a GABA transporter, a G protein-gated potassium channel, and calcium channels. His interests also extended to synaptic plasticity, and he helped to define the role of neuronal nitric oxide synthase and of trkB receptors. His final experiments concerned the role of protein kinase A in long-term potentiation. (The abstract was written posthumously by a colleague.)", "doi": "10.1146/annurev.biochem.72.121801.161905", "issn": "0066-4154", "publisher": "Annual Reviews", "publication": "Annual Review of Biochemistry", "publication_date": "2002-07", "volume": "71", "pages": "13-24" }, { "id": "authors:d2t2m-1zx50", "collection": "authors", "collection_id": "d2t2m-1zx50", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:YUTpnas01", "type": "article", "title": "gamma-Aminobutyric acid type A receptors modulate cAMP-mediated long-term potentiation and long-term depression at monosynaptic CA3-CA1 synapses", "author": [ { "family_name": "Yu", "given_name": "Tzu-ping", "clpid": "Yu-Tzu-ping" }, { "family_name": "McKinney", "given_name": "Sheri", "clpid": "McKinney-S" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "cAMP induces a protein-synthesis-dependent late phase of longterm potentiation (LTP) at CA3-CA1 synapses in acute hippocampal slices. Herein we report cAMP-mediated LTP and long-term depression (LTD) at monosynaptic CA3-CA1 cell pairs in organotypic hippocampal slice cultures. After bath application of the membrane-permeable cAMP analog adenosine 3 ' ,5 ' -cyclic monophosphorothioate, Sp isomer (Sp-cAMPS), synaptic transmission was enhanced for at least 2 h. Consistent with previous findings, the late phase of LTP requires activation of cAMP-dependent protein kinase A and protein synthesis. There is also an early phase of LTP induced by cAMP; the early phase depends on protein kinase A but, in contrast to the later phase, does not require protein synthesis, in addition, the cAMP-induced LTP is associated with a reduction of paired-pulse facilitation, suggesting that presynaptic modification may be involved. Furthermore, we found that Sp-cAMPS induced LTD in slices pretreated with picrotoxin, a gamma -aminobutyric acid type A (GABA(A)) receptor antagonist. This form of LTD depends on protein synthesis and protein phosphatase(s) and is accompanied by an increased ratio of failed synaptic transmission. These results suggest that GABA(A) receptors can modulate the effect of cAMP on synaptic transmission and thus determine the direction of synaptic plasticity.", "doi": "10.1073/pnas.091093998", "pmcid": "PMC33198", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "2001-04-24", "series_number": "9", "volume": "98", "issue": "9", "pages": "5264-5269" }, { "id": "authors:9cv3w-vb247", "collection": "authors", "collection_id": "9cv3w-vb247", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:KHApnas01a", "type": "article", "title": "Activation-dependent changes in receptor distribution and dendritic morphology in hippocampal neurons expressing P2X(2)-green fluorescent protein receptors", "author": [ { "family_name": "Khakh", "given_name": "Baljit S.", "clpid": "Khakh-B-S" }, { "family_name": "Smith", "given_name": "W. Bryan", "clpid": "Smith-W-B" }, { "family_name": "Chiu", "given_name": "Chi-Sung", "clpid": "Chiu-Chi-Sung" }, { "family_name": "Ju", "given_name": "Donghong", "clpid": "Ju-Donghong" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "ATP-gated P2X(2) receptors are widely expressed in neurons, but the cellular effects of receptor activation are unclear. We engineered functional green fluorescent protein (GFP)-tagged P2X(2) receptors and expressed them in embryonic hippocampal neurons, and report an approach to determining functional and total receptor pool sizes in living cells. ATP application to dendrites caused receptor redistribution and the formation of varicose hot spots of higher P2X(2)-GFP receptor density. Redistribution in dendrites was accompanied by an activation-dependent enhancement of the ATP-evoked current. Substate-specific mutant T18A P2X(2)-GFP receptors showed no redistribution or activation-dependent enhancement of the ATP-evoked current. Thus fluorescent P2X(2)-GFP receptors function normally, can be quantified, and reveal the dynamics of P2X(2) receptor distribution on the seconds time scale.", "doi": "10.1073/pnas.081089198", "pmcid": "PMC33202", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "2001-04-24", "series_number": "9", "volume": "98", "issue": "9", "pages": "5288-5293" }, { "id": "authors:mfr1v-ag708", "collection": "authors", "collection_id": "mfr1v-ag708", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20200612-115646596", "type": "article", "title": "Modulation of early growth response (EGR) transcription factor-dependent gene expression by using recombinant adenovirus", "author": [ { "family_name": "Ehrengruber", "given_name": "Markus U.", "clpid": "Ehrengruber-M-U" }, { "family_name": "Muhlebach", "given_name": "Stephan G.", "clpid": "Muhlebach-S-G" }, { "family_name": "S\u00f6hrman", "given_name": "Sophia", "clpid": "S\u00f6hrman-S" }, { "family_name": "Leutenegger", "given_name": "Christian M.", "clpid": "Leutenegger-C-M" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Early growth response (EGR) transcription factors link initial cytoplasmic events to long-term alterations of cellular gene expression and are induced by various stimuli. To test their roles in cell physiology, we constructed adenoviral recombinants encoding NGFI-A binding protein 2 (NAB2, a repressor of EGR1, EGR2, and EGR3), EGR1, NAB-insensitive EGR1(I293F) (EGR1\u2217), EGR2, and the NAB-binding, repressive domain 1 (R1) of EGR1. These viruses regulated EGR-dependent expression of GFP and luciferase reporter genes in heterologous expression assays. Infection of a myoblast cell line with EGR1 and EGR1\u2217 adenovirus induced the endogenous gene for platelet-derived growth factor A chain (PDGF-A). In addition, in neuroblastoma cells, the two novel EGR1 target genes EGR3 and NAB2 were identified by using adenoviral transfer of EGR1 and EGR1\u2217. Our results demonstrate that recombinant adenovirus is useful to regulate heterologous and endogenous EGR target gene expression, and suggest that EGR transcription factors can autoregulate themselves.", "doi": "10.1016/s0378-1119(00)00445-5", "issn": "0378-1119", "publisher": "Elsevier", "publication": "Gene", "publication_date": "2000-11-27", "series_number": "1-2", "volume": "258", "issue": "1-2", "pages": "63-69" }, { "id": "authors:c9hg4-xq390", "collection": "authors", "collection_id": "c9hg4-xq390", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:MCPjbc98", "type": "article", "title": "Evidence for a Functional Interaction between Integrins and G Protein-activated Inward Rectifier K+ Channels", "author": [ { "family_name": "McPhee", "given_name": "Jancy C.", "clpid": "McPhee-J-C" }, { "family_name": "Dang", "given_name": "Yan L.", "clpid": "Dang-Yan-L" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Heteromultimeric G protein-activated inward rectifier K+ (GIRK) channels, abundant in heart and brain, help to determine the cellular membrane potential as well as the frequency and duration of electrical impulses. The sequence arginine-glycine-aspartate (RGD), located extracellularly between the first membrane-spanning region and the pore, is conserved among all identified GIRK subunits but is not found in the extracellular domain of any other cloned K+ channels. Many integrins, which, like channels, are integral membrane proteins, recognize this RGD sequence on other proteins, usually in the extracellular matrix. We therefore asked whether GIRK activity might be regulated by direct interaction with integrin. Here, we present evidence that mutation of the RGD site to RGE, particularly on the GIRK4 subunit, decreases or abolishes GIRK current. Furthermore, wild-type channels can be co-immunoprecipitated with integrin. The total cellular amount of expressed mutant GIRK channel protein is the same as the wild-type protein; however, the amount of mutant channel protein that localizes to the plasma membrane is decreased relative to wild-type, most likely accounting for the diminished GIRK current detected. GIRK channels appear to bind directly to integrin and to require this interaction for proper GIRK channel membrane localization and function.", "issn": "0021-9258", "publisher": "American Society for Biochemistry and Molecular Biology", "publication": "Journal of Biological Chemistry", "publication_date": "1998-12-25", "series_number": "52", "volume": "273", "issue": "52", "pages": "34696-34702" }, { "id": "authors:6zkjs-cc024", "collection": "authors", "collection_id": "6zkjs-cc024", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20220223-204480000", "type": "article", "title": "Enhancement of Neurotransmitter Release Induced by Brain-Derived Neurotrophic Factor in Cultured Hippocampal Neurons", "author": [ { "family_name": "Li", "given_name": "Yong-Xin", "clpid": "Li-Yong-Xin" }, { "family_name": "Zhang", "given_name": "Yinong", "clpid": "Zhang-Yinong" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Schuman", "given_name": "Erin M.", "orcid": "0000-0002-7053-1005", "clpid": "Schuman-E-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Brain-derived neurotrophic factor (BDNF), like other neurotrophins, has long-term effects on neuronal survival and differentiation; furthermore, recent work has shown that BDNF also can induce rapid changes in synaptic efficacy. We have investigated the mechanism(s) of these synaptic effects on cultured embryonic hippocampal neurons. In the presence of the GABAA receptor antagonist, picrotoxin, the application of BDNF (100 ng/ml) for 1\u20135 min increased the amplitude of evoked synaptic currents by 48 \u00b1 9% in 10 of 15 pairs of neurons and increased the frequency of EPSC bursts to 205 \u00b1 20% of the control levels. There was no detectable effect of BDNF on various measures of electrical excitability, including the resting membrane potential, input resistance, action potential threshold, and action potential amplitude. In addition, BDNF did not change the postsynaptic currents induced by the exogenous application of glutamate. BDNF did increase the frequency of miniature EPSCs (mEPSCs) (268.0 \u00b1 46.8% of control frequency), however, without affecting the mEPSC amplitude. The effect of BDNF on mEPSC frequency was blocked by the tyrosine kinase inhibitor K252a and also by the removal of extracellular calcium ([Ca\u00b2\u207a]\u2092). Fura-2 recordings showed that BDNF elicited an increase in intracellular calcium concentration ([Ca\u00b2\u207a]\ua700). This effect was dependent on [Ca\u00b2\u207a]\u2092; it was blocked by K252a and by thapsigargin, but not by caffeine. The results demonstrate that BDNF enhances glutamatergic synaptic transmission at a presynaptic locus and that this effect is accompanied by a rise in [Ca\u00b2\u207a]\ua700 that requires the release of Ca\u00b2\u207a from IP3-gated stores.", "doi": "10.1523/jneurosci.18-24-10231.1998", "pmcid": "PMC6793341", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "1998-12-15", "series_number": "24", "volume": "18", "issue": "24", "pages": "10231-10240" }, { "id": "authors:0e4a0-ejg41", "collection": "authors", "collection_id": "0e4a0-ejg41", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:LIYpnas98", "type": "article", "title": "Expression of a dominant negative TrkB receptor, T1, reveals a requirement for presynaptic signaling in BDNF-induced synaptic potentiation in cultured hippocampal neurons", "author": [ { "family_name": "Li", "given_name": "Yong-Xin", "clpid": "Li-Yong-Xin" }, { "family_name": "Xu", "given_name": "Youfeng", "clpid": "Xu-Youfeng" }, { "family_name": "Ju", "given_name": "Donghong", "clpid": "Ju-Donghong" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Schuman", "given_name": "Erin M.", "orcid": "0000-0002-7053-1005", "clpid": "Schuman-E-M" } ], "abstract": "We have developed a method to analyze the relative contributions of pre- and postsynaptic actions of a particular gene product in neurons in culture and potentially in slices using adenovirus-mediated gene transfer. A recombinant virus directed the expression of both a GFP reporter protein and TrkB.T1, a C-terminal truncated dominant negative TrkB neurotrophin receptor. When expressed in the presynaptic cell at synapses between embryonic hippocampal neurons in culture, the dominant negative TrkB.T1 inhibited two forms of synaptic potentiation induced by the neurotrophin brain-derived neurotrophic factor (BDNF): (i) greater evoked synaptic transmission and (ii) higher frequency of spontaneous miniature synaptic currents. These inhibition effects are not seen if the transgene is expressed only in the postsynaptic cell. We conclude that BDNF-TrkB signal transduction in the presynaptic terminal leads to both types of potentiation and is therefore the primary cause of synaptic enhancement by BDNF in these neurons.", "pmcid": "PMC27990", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1998-09-01", "series_number": "18", "volume": "95", "issue": "18", "pages": "10884-10889" }, { "id": "authors:g26ma-b3126", "collection": "authors", "collection_id": "g26ma-b3126", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:QUZjcb98", "type": "article", "title": "The Transcriptional Corepressor NAB2 Inhibits NGF-induced Differentiation of PC12 Cells", "author": [ { "family_name": "Qu", "given_name": "Zhican", "clpid": "Qu-Zhican" }, { "family_name": "Wolfraim", "given_name": "Lawrence A.", "clpid": "Wolfraim-L-A" }, { "family_name": "Svaren", "given_name": "John", "clpid": "Svaren-J" }, { "family_name": "Ehrengruber", "given_name": "Markus U.", "clpid": "Ehrengruber-M-U" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Milbrandt", "given_name": "Jeffrey", "clpid": "Milbrandt-J" } ], "abstract": "The PC12 pheochromocytoma cell line responds to NGF by undergoing growth arrest and proceeding to differentiate toward a neuronal phenotype. Among the early genetic events triggered by NGF in PC12 cells are the rapid activation of the zinc finger transcription factor Egr1/NGFI-A, and a slightly delayed induction of NAB2, a corepressor that inhibits Egr1 transcriptional activity. We found that stably transfected PC12 cells expressing high levels of NAB2 do not differentiate, but rather continue to proliferate in response to NGF. Inhibition of PC12 differentiation by NAB2 overexpression was confirmed using two additional experimental approaches, transient transfection, and adenoviral infection. Early events in the NGF signaling cascade, such as activation of MAP kinase and induction of immediate-early genes, were unaltered in the NAB2-overexpressing PC12 cell lines. However, induction of delayed NGF response genes such as TGF-beta 1 and MMP-3 was inhibited. Furthermore, NAB2 overexpression led to downregulation of p21WAF1, a molecule previously shown to play a pivotal role in the ability of PC12 cells to undergo growth arrest and commit to differentiation in response to NGF. Cotransfection with p21WAF1 restored the ability of NAB2-overexpressing PC12 cells to differentiate in response to NGF.", "doi": "10.1083/jcb.142.4.1075", "pmcid": "PMC2132876", "issn": "0021-9525", "publisher": "Rockefeller University Press", "publication": "Journal of Cell Biology", "publication_date": "1998-08-24", "series_number": "4", "volume": "142", "issue": "4", "pages": "1075-1082" }, { "id": "authors:030t7-f8b69", "collection": "authors", "collection_id": "030t7-f8b69", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:ENGpnas97", "type": "article", "title": "Site-specific, photochemical proteolysis applied to ion channels in vivo", "author": [ { "family_name": "England", "given_name": "Pamela M.", "clpid": "England-P-M" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Dougherty", "given_name": "Dennis A.", "orcid": "0000-0003-1464-2461", "clpid": "Dougherty-D-A" } ], "abstract": "A method for site-specific, nitrobenzyl-induced photochemical proteolysis of diverse proteins expressed in living cells has been developed based on the chemistry of the unnatural amino acid (2-nitrophenyl)glycine (Npg). Using the in vivo nonsense codon suppression method for incorporating unnatural amino acids into proteins expressed in Xenopus oocytes, Npg has been incorporated into two ion channels: the Drosophila Shaker B K+ channel and the nicotinic acetylcholine receptor. Functional studies in vivo show that irradiation of proteins containing an Npg residue does lead to peptide backbone cleavage at the site of the novel residue. Using this method, evidence is obtained for an essential functional role of the \"signature\" Cys128-Cys142 disulfide loop of the nAChR alpha subunit.", "doi": "10.1073/pnas.94.20.11025", "pmcid": "PMC23572", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1997-09-30", "series_number": "20", "volume": "94", "issue": "20", "pages": "11025-11030" }, { "id": "authors:g2669-h3v47", "collection": "authors", "collection_id": "g2669-h3v47", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:DOUpnas97", "type": "article", "title": "RGS proteins reconstitute the rapid gating kinetics of G\u03b2\u03b3-activated inwardly rectifying K^+\u2009channels", "author": [ { "family_name": "Doupnik", "given_name": "Craig A.", "clpid": "Doupnik-C-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Kofuji", "given_name": "Paulo", "clpid": "Kofuji-Paulo" } ], "abstract": "G protein gated inward rectifier K+ (GIRK) channels mediate hyperpolarizing postsynaptic potentials in the nervous system and in the heart during activation of G alpha(i/o) coupled receptors. In neurons and cardiac atrial cells the time course for receptor-mediated GIRK current deactivation is 20-40 times faster than that observed in heterologous systems expressing cloned receptors and GIRK channels, suggesting that an additional component(s) is required to confer the rapid kinetic properties of the native transduction pathway. We report here that heterologous expression of \"regulators of G protein signaling\" (RGS proteins), along with cloned G protein-coupled receptors and GIRK channels, reconstitutes the temporal properties of the native receptor --> GIRK signal transduction pathway. GIRK current waveforms evoked by agonist activation of muscarinic m(2) receptors or serotonin 1A receptors were dramatically accelerated by coexpression of either RGS1, RGS3, or RGS4, but not RGS2. For the brain-expressed RGS4 isoform, neither the current amplitude nor the steady-state agonist dose-response relationship was significantly affected by RGS expression, although the agonist-independent \"basal\" GIRK current was suppressed by approximate to 40%. Because GIRK activation and deactivation kinetics are the limiting rates for the onset and termination of \"slow\" postsynaptic inhibitory currents in neurons and atrial cells, RGS proteins may play crucial roles in the timing of information transfer within the brain and to peripheral tissues.", "pmcid": "PMC23385", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1997-09-16", "series_number": "19", "volume": "94", "issue": "19", "pages": "10461-10466" }, { "id": "authors:vj1en-bjk20", "collection": "authors", "collection_id": "vj1en-bjk20", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:EHRpnas97", "type": "article", "title": "Activation of heteromeric G protein-gated inward rectifier K+ channels overexpressed by adenovirus gene transfer inhibits the excitability of hippocampal neurons", "author": [ { "family_name": "Ehrengruber", "given_name": "Markus U.", "clpid": "Ehrengruber-M-U" }, { "family_name": "Doupnik", "given_name": "Craig A.", "clpid": "Doupnik-C-A" }, { "family_name": "Xu", "given_name": "Youfeng", "clpid": "Xu-Youfeng" }, { "family_name": "Garvey", "given_name": "Justine", "clpid": "Garvey-J-S" }, { "family_name": "Jasek", "given_name": "Mark C.", "clpid": "Jasek-M-C" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "G protein-gated inward rectifier K+ channel subunits 1-4(GIRK1-4) have been cloned from neuronal and atrial tissue and function as heterotetramers. To examine the inhibition of neuronal excitation by GIRKs, we overexpressed GIRKs in cultured hippocampal neurons from 18 day rat embryos, which normally lack or show low amounts of GIRK protein and currents. Adenoviral recombinants containing the cDNAs for GIRK1, GIRK2, GIRK4, and the serotonin 1A receptor were constructed. Typical GIRK currents could be activated by endogenous GABA(B), serotonin 5-HT1A, and adenosine A1 receptors in neurons coinfected with GIRK1+2 or GIRK1+4. Under current clamp, GIRK activation increased the cell membrane conductance by 1- to 2-fold, hyperpolarized the cell by 11-14 mV,and inhibited action potential firing by increasing, the threshold current for firing by 2- to 3-fold. These effects were not found in non- and mock-infected neurons, and were similar to the effects of muscarinic stim ulation of native GIRK currents in atrial myocytes. Two inhibitory effects of GIRK activation, hyperpolarization and diminution of depolarizing pulses, were simulated from the experimental data. These inhibitory effects are physiologically important in the voltage range between the resting membrane potential and the potential where voltage-gated Na+ and K+ currents are activated; that is where GIRK currents are outward.", "pmcid": "PMC21286", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1997-06-24", "series_number": "13", "volume": "94", "issue": "13", "pages": "7070-7075" }, { "id": "authors:7r36m-a2f93", "collection": "authors", "collection_id": "7r36m-a2f93", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20191030-140944005", "type": "article", "title": "Second Messengers, Trafficking-Related Proteins, and Amino Acid Residues that Contribute to the Functional Regulation of the Rat Brain GABA Transporter GAT1", "author": [ { "family_name": "Quick", "given_name": "Michael W.", "clpid": "Quick-M-W" }, { "family_name": "Corey", "given_name": "Janis L.", "clpid": "Corey-J-L" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Recent evidence indicates that several members of the Na\u207a-coupled transporter family are regulated, and this regulation in part occurs by redistribution of transporters between intracellular locations and the plasma membrane. We elucidate components of this process for both wild-type and mutant GABA transporters (GAT1) expressed in Xenopus oocytes using a combination of uptake assays, immunoblots, and electrophysiological measurements of membrane capacitance, transport-associated currents, and GAT1-specific charge movements. At low GAT1 expression levels, activators of protein kinase C (PKC) induce redistribution of GAT1 from intracellular vesicles to the plasma membrane; at higher GAT1 expression levels, activators of PKC fail to induce this redistribution. However, coinjection of total rat brain mRNA with GAT1 permits PKC-mediated modulation at high transporter expression levels. This effect of brain mRNA on modulation is mimicked by coinjection of syntaxin 1a mRNA and is eliminated by injecting synaptophysin or syntaxin antisense oligonucleotides. Additionally, botulinum toxins, which inactivate proteins involved in vesicle release and recycling, reduce basal GAT1 expression and prevent PKC-induced translocation. Mutant GAT1 proteins, in which most or all of a leucine heptad repeat sequence was removed, display altered basal distribution and lack susceptibility to modulation by PKC, delineating one region of GAT1 necessary for its targeting. Thus, functional regulation of GAT1 in oocytes occurs via components common to transporters and to trafficking in both neural and non-neural cells, and suggests a relationship between factors that control neurotransmitter secretion and the components necessary for neurotransmitter uptake.", "doi": "10.1523/jneurosci.17-09-02967.1997", "pmcid": "PMC6573650", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "1997-05-01", "series_number": "9", "volume": "17", "issue": "9", "pages": "2967-2979" }, { "id": "authors:36jff-scs18", "collection": "authors", "collection_id": "36jff-scs18", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:SILpnas96", "type": "article", "title": "A regenerative link in the ionic fluxes through the weaver potassium channel underlies the pathophysiology of the mutation", "author": [ { "family_name": "Silverman", "given_name": "Scott K.", "clpid": "Silverman-S-K" }, { "family_name": "Kofuji", "given_name": "Paulo", "clpid": "Kofuji-P" }, { "family_name": "Dougherty", "given_name": "Dennis A.", "orcid": "0000-0003-1464-2461", "clpid": "Dougherty-D-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The homozygous weaver mouse displays neuronal degeneration in several brain regions. Previous experiments in heterologous expression systems showed that the G protein-gated inward rectifier K+ channel (GIRK2) bearing the weaver pore-region GYG-to-SYG mutation (i) is not activated by G(beta gamma) subunits, but instead shows constitutive activation, and (ii) is no longer a K+-selective channel but conducts Na+ as well. The present experiments on weaverGIRK2 (wv-GIRK2) expressed in Xenopus oocytes show that the level of constitutive activation depends on Intracellular Na+ concentration. In particular, manipulations that decrease intracellular Na+ produce a component of Na+-permeable current activated via a G protein pathway. Therefore, constitutive activation may not arise because the weaver mutation directly alters the gating transitions of the channel protein. Instead, there may be a regenerative cycle of Na+ influx through the wvGIRK2 channel, leading to additional Na+ activation. We also show that the wvGIRK2 channel is permeable to Ca2+, providing an additional mechanism for the degeneration that characterizes the weaver phenotype. We further demonstrate that the GIRK4 channel bearing the analogous weaver mutation has properties similar to those of the wvGIRK2 channel, providing a glimpse of the selective pressures that have maintained the GYG sequence in nearly all known K+ channels.", "doi": "10.1073/pnas.93.26.15429", "pmcid": "PMC26421", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1996-12-24", "series_number": "26", "volume": "93", "issue": "26", "pages": "15429-15434" }, { "id": "authors:e6csj-gev35", "collection": "authors", "collection_id": "e6csj-gev35", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:QUIjbc96", "type": "article", "title": "Desensitization of Inositol 1,4,5-Trisphosphate/Ca2+-induced Cl- Currents by Prolonged Activation of G Proteins in Xenopus Oocytes", "author": [ { "family_name": "Quick", "given_name": "Michael W.", "clpid": "Quick-M-W" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Simon", "given_name": "Melvin I.", "clpid": "Simon-M-I" }, { "family_name": "Aragay", "given_name": "Anna M.", "clpid": "Aragay-A-M" } ], "abstract": "Expression of G protein alpha subunits of the Gq family with various G protein-coupled receptors induces activation of an inositol 1,4,5-trisphosphate (IP3)/Ca2+-mediated Cl- conductance in Xenopus oocytes. Our present data show that two members of this family, the human Galpha 16 subunit and the murine homologue Galpha 15, can induce both activation and inhibition of these agonist-induced currents. Although extremely low amounts (10-50 pg) of injected Galpha 16 subunit cRNA cause modest (~2-fold) enhancement of ligand-induced Cl- currents in oocytes co-injected with thyrotropin-releasing hormone (TRH) receptor cRNA 48 h postinjection, larger Galpha 16 and Galpha 15 cRNA injections cause >10-fold inhibition of TRH or 5HT2c receptor responses. The inhibition is analyzed in this study. The inhibited currents are recovered if various Gbeta gamma subunit combinations are also expressed with the Galpha subunits. The constitutively active mutant, Galpha 16Q212L, also causes a strong attenuation of the ligand-induced Cl- currents, but this inhibition is not recovered by co-expression of Gbeta gamma subunits. These results indicate that the free Galpha subunit is responsible for the inhibitory signal. Although expression of TRH receptor alone produces maximum responses approximately 48 h after injection, co-expression of TRH receptor with Galpha 16 results in enhanced responses 6-12 h postinjection, followed by complete attenuation at 36 h. Furthermore, injection of Galpha 16 cRNA alone at comparable levels gives rise to spontaneous Cl- currents within 6-12 h postinjection, suggesting that the early spontaneous activation underlies the later suppression. Expression of other G protein alpha subunits of the Gq family, at cRNA levels considerably higher than effective for Galpha 16, produces both analogous spontaneous Cl- currents and, later, inhibition of ligand-induced Cl- currents. Experiments with direct injection of IP3 and of Ca2+ suggest that this inhibition is consistent with the down-regulation of IP3 receptors. These data indicate that both enhancement and inhibition of signaling through G protein-coupled receptors can be mediated by the expression level and/or activity of an individual G protein.", "issn": "0021-9258", "publisher": "American Society for Biochemistry and Molecular Biology", "publication": "Journal of Biological Chemistry", "publication_date": "1996-12-13", "series_number": "50", "volume": "271", "issue": "50", "pages": "32021-32027" }, { "id": "authors:r0wz7-p1613", "collection": "authors", "collection_id": "r0wz7-p1613", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20150113-161505157", "type": "article", "title": "A Role for Endothelial NO Synthase in LTP Revealed by Adenovirus-Mediated Inhibition and Rescue", "author": [ { "family_name": "Kantor", "given_name": "David B.", "clpid": "Kantor-D-B" }, { "family_name": "Lanzrein", "given_name": "Markus", "clpid": "Lanzrein-M" }, { "family_name": "Stary", "given_name": "S. Jennifer", "clpid": "Stary-S-J" }, { "family_name": "Sandoval", "given_name": "Gisela M.", "clpid": "Sandoval-G-M" }, { "family_name": "Smith", "given_name": "W. Bryan", "clpid": "Smith-W-B" }, { "family_name": "Sullivan", "given_name": "Brian M.", "clpid": "Sullivan-B-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Schuman", "given_name": "Erin M.", "orcid": "0000-0002-7053-1005", "clpid": "Schuman-E-M" } ], "abstract": "Pharmacological studies support the idea that nitric oxide (NO) serves as a retrograde messenger during long-term potentiation (LTP) in area CA1 of the hippocampus. Mice with a defective form of the gene for neuronal NO synthase (nNOS), however, exhibit normal LTP. The myristoyl protein endothelial NOS (eNOS) is present in the dendrites of CA1 neurons. Recombinant adenovirus vectors containing either a truncated eNOS (a putative dominant negative) or an eNOS fused to a transmembrane protein were used to demonstrate that membrane-targeted eNOS is required for LTP. The membrane localization of eNOS may optimally position the enzyme both to respond to Ca^(2+) influx and to release NO into the extracellular space during LTP induction.", "doi": "10.1126/science.274.5293.1744", "issn": "0036-8075", "publisher": "American Association for the Advancement of Science", "publication": "Science", "publication_date": "1996-12-06", "series_number": "5293", "volume": "274", "issue": "5293", "pages": "1744-1748" }, { "id": "authors:kqt24-rw065", "collection": "authors", "collection_id": "kqt24-rw065", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20191030-155045434", "type": "article", "title": "Ion Binding and Permeation at the GABA Transporter GAT1", "author": [ { "family_name": "Mager", "given_name": "Sela", "clpid": "Mager-Sela" }, { "family_name": "Kleinberger-Doron", "given_name": "Nurit", "clpid": "Kleinberger-Doron-Nurit" }, { "family_name": "Keshet", "given_name": "Gilmor I.", "clpid": "Keshet-Gilmor-I" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Kanner", "given_name": "Baruch I.", "clpid": "Kanner-Baruch-I" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "This study addresses the binding of ions and the permeation of substrates during function of the GABA transporter GAT1. GAT1 was expressed in Xenopus oocytes and studied electrophysiologically as well as with [\u00b3H]GABA flux; GAT1 was also expressed in mammalian cells and studied with [\u00b3H]GABA and [\u00b3H]tiagabine binding. Voltage jumps, Na\u207a and Cl\u207b concentration jumps, and exposure to high-affinity blockers (NO-05-711 and SKF-100330A) all produce capacitive charge movements. Occlusive interactions among these three types of perturbations show that they all measure the same population of charges. The concentration dependences of the charge movements reveal (1) that two Na\u207a ions interact with the transporter even in the absence of GABA, and (2) that Cl\u207b facilitates the binding of Na\u207a. Comparison between the charge movements and the transport-associated current shows that this initial Na\u207a-transporter interaction limits the overall transport rate when [GABA] is saturating. However, two classes of manipulation\u2014treatment with high-affinity uptake blockers and the W68L mutation\u2014\"lock\" Na\u207a onto the transporter by slowing or preventing the subsequent events that release the substrates to the intracellular medium. The Na\u207a substitutes Li\u207a and Cs\u207a do not support charge movements, but they can permeate the transporter in an uncoupled manner. Our results (1) support the hypothesis that efficient removal of synaptic transmitter by the GABA transporter GAT1 depends on the previous binding of Na\u207a and Cl\u207b, and (2) indicate the important role of the conserved putative transmembrane domain 1 in interactions with the permeant substrates.", "doi": "10.1523/jneurosci.16-17-05405.1996", "pmcid": "PMC6578888", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "1996-09-01", "series_number": "17", "volume": "16", "issue": "17", "pages": "5405-5414" }, { "id": "authors:atfxh-7fk74", "collection": "authors", "collection_id": "atfxh-7fk74", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20150610-111824247", "type": "article", "title": "Inhibition of an inwardly rectifying K^+ channel by G-protein \u0251-subunits", "author": [ { "family_name": "Schreibmayer", "given_name": "Wolfgang", "clpid": "Schreibmayer-W" }, { "family_name": "Dessauer", "given_name": "Carmen W.", "clpid": "Dessauer-C-W" }, { "family_name": "Voroblov", "given_name": "Dmitry", "clpid": "Voroblov-E" }, { "family_name": "Gilman", "given_name": "Alfred G.", "clpid": "Gilman-A-G" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" } ], "abstract": "CHOLINERGIC muscarinic, serotonergic, opioid and several other G-protein-coupled neurotransmitter receptors activate inwardly rectifying K^+ channels of the GIRK family, slowing the heartbeat and decreasing the excitability of neuronal cells. Inhibitory modulation of GIRKs by G-protein-coupled receptors may have important implications in cardiac and brain physiology. Previously G_\u03b1 and G_(\u03b2\u03b3) subunits of heterotrimeric G proteins have both been implicated in channel opening, but recent studies attribute this role primarily to the G_(\u03b2\u03b3) dimer that activates GIRKs in a membrane-delimited fashion, probably by direct binding to the channel protein. We report here that free GTP\u03b3S-activated G_(\u03b1il), but not G_(\u03b1i2) or G_(\u03b1i3), potently inhibits G_(\u03b21\u03b32)-induced GIRK activity in excised membrane patches of Xenopus oocytes expressing GIRK1. High-affinity but partial inhibition is produced by G_(\u03b1s)-GTP\u03b3S. G_(\u03b1il)-GTP\u03b3S also inhibits G_(\u03b2l\u03b32)-activated GIRK in atrial myocytes. Antagonistic interactions between G_\u03b1 and G_(\u03b2\u03b3) may be among the mechanisms determining specificity of G protein coupling to GIRKs.", "doi": "10.1038/380624a0", "issn": "0028-0836", "publisher": "Nature Publishing Group", "publication": "Nature", "publication_date": "1996-04-18", "series_number": "6575", "volume": "380", "issue": "6575", "pages": "624-627" }, { "id": "authors:wfcdz-8zp09", "collection": "authors", "collection_id": "wfcdz-8zp09", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120208-075012754", "type": "article", "title": "Voltage-Jump Relaxation Kinetics for Wild-type and Chimeric \u03b2 Subunits of Neuronal Nicotinic Receptors", "author": [ { "family_name": "Figl", "given_name": "Antonio", "clpid": "Figl-A" }, { "family_name": "Labarca", "given_name": "Cesar", "clpid": "Labarca-C" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Cohen", "given_name": "Bruce N.", "clpid": "Cohen-B-N" } ], "abstract": "We have studied the voltage-jump relaxation currents for a series of neuronal nicotinic acetylcholine receptors resulting from the coexpression of wild-type and chimeric \u03b24/\u03b22 subunits with \u03b13 subunits in Xenopus oocytes. With acetylcholine as the agonist, the wild-type \u03b13\u03b24 receptors displayed five- to eightfold slower voltage-jump relaxations than did the wild-type \u03b13\u03b22 receptors. In both cases, the relaxations could best be described by two exponential components of approximately equal amplitudes over a wide range of [ACh]'s. Relaxation rate constants increased with [ACh] and saturated at 20- to 30-fold lower concentrations for the \u03b13\u03b22 receptor than for the \u03b13\u03b24 receptor, as observed previously for the peak steady state conductance. Furthermore, the chimeric \u03b24/\u03b22 subunits showed a transition in the concentration dependence of the rate constants in the region between residues 94 and 109, analogous to our previous observation with steady state conductances. However, our experiments with a series of \u03b2-subunit chimeras did not localize residues that govern the absolute value of the kinetic parameters. Hill coefficients for the relaxations also differed from those previously measured for steady state responses. The data reinforce previous conclusions that the region between residues 94 and 109 on the \u03b2 subunit plays a role in binding agonist but also show that other regions of the receptor control gating kinetics subsequent to the binding step.", "doi": "10.1085/jgp.107.3.369", "pmcid": "PMC2216994", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1996-03", "series_number": "3", "volume": "107", "issue": "3", "pages": "369-379" }, { "id": "authors:64htz-w3g22", "collection": "authors", "collection_id": "64htz-w3g22", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:DASpnas95", "type": "article", "title": "Inhibition of function in Xenopus oocytes of the inwardly rectifying G-protein-activated atrial K channel (GIRK1) by overexpression of a membrane-attached form of the C-terminal tail", "author": [ { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Doupnik", "given_name": "Craig A.", "clpid": "Doupnik-C-A" }, { "family_name": "Ivanina", "given_name": "Tatiana", "clpid": "Ivanina-T" }, { "family_name": "Bausch", "given_name": "Suzanne", "clpid": "Bausch-S" }, { "family_name": "Wang", "given_name": "Weizhen", "clpid": "Wang-Weizhen" }, { "family_name": "Lin", "given_name": "Catherine", "clpid": "Lin-Catherine-P" }, { "family_name": "Garvey", "given_name": "Justine", "clpid": "Garvey-J-S" }, { "family_name": "Chavkin", "given_name": "Charles", "clpid": "Chavkin-C" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Coexpression in Xenopus oocytes of the inwardly rectifying guanine nucleotide binding (G)-protein-gated K channel GIRK1 with a myristoylated modification of the (putative) cytosolic C-terminal tail [GIRK1 aa 183-501 fused in-frame to aa 1-15 of p60src and denoted src+ (183-501)] leads to a high degree of inhibition of the inward G-protein-gated K+ current. The nonmyristoylated segment, src- (183-501), is not active. Although some interference with assembly is not precluded, the evidence indicates that the main mechanism of inhibition is interference with functional activation of the channel by G proteins. In part, the tail functions as a blocking particle similar to a \"Shaker ball\"; it may also function by competing for the available supply of free G beta gamma liberated by hormone activation of a seven-helix receptor. The non-G-protein-gated weak inward rectifier ROMK1 is less effectively inhibited, and a Shaker K channel was not inhibited. Immunological assays show the presence of a high concentration of src+ (183-501) in the plasma membrane and the absence of any membrane forms for the nonmyristoylated segment.", "doi": "10.1073/pnas.92.15.6758", "pmcid": "PMC41408", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1995-07-18", "series_number": "15", "volume": "92", "issue": "15", "pages": "6758-6762" }, { "id": "authors:aq7nh-36581", "collection": "authors", "collection_id": "aq7nh-36581", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:KOFpnas95", "type": "article", "title": "Evidence that neuronal G-protein-gated inwardly rectifying K+ channels are activated by G\u03b2\u03b3 subunits and function as heteromultimers", "author": [ { "family_name": "Kofuji", "given_name": "Paulo", "clpid": "Kofuji-Paulo" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Guanine nucleotide-binding proteins (G proteins) activate K+ conductances in cardiac atrial cells to slow heart rate and in neurons to decrease excitability. cDNAs encoding three isoforms of a G-protein-coupled, inwardly rectifying K+ channel (GIRK) have recently been cloned from cardiac (GIRK1/Kir 3.1) and brain cDNA libraries (GIRK2/Kir 3.2 and GIRK3/Kir 3.3). Here we report that GIRK2 but not GIRK3 can be activated by G protein subunits G\u03b21 and G2 in Xenopus oocytes. Furthermore, when either GIRK3 or GIRK2 was coexpressed with GIRK1 and activated either by muscarinic receptors or by G\u03b2 subunits, G-protein-mediated inward currents were increased by 5- to 40-fold. The single-channel conductance for GIRK1 plus GIRK2 coexpression was intermediate between those for GIRK1 alone and for GIRK2 alone, and voltage-jump kinetics for the coexpressed channels displayed new kinetic properties. On the other hand, coexpression of GIRK3 with GIRK2 suppressed the GIRK2 alone response. These studies suggest that formation of heteromultimers involving the several GIRKs is an important mechanism for generating diversity in expression level and function of neurotransmitter-coupled, inward rectifier K+ channels.", "doi": "10.1073/pnas.92.14.6542", "pmcid": "PMC41554", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1995-07-03", "series_number": "14", "volume": "92", "issue": "14", "pages": "6542-6546" }, { "id": "authors:5dd26-qqj47", "collection": "authors", "collection_id": "5dd26-qqj47", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120216-103326772", "type": "article", "title": "Intrinsic Gating Properties of a Cloned G Protein-activated Inward Rectifier K^+ Channel", "author": [ { "family_name": "Doupnik", "given_name": "Craig A.", "clpid": "Doupnik-C-A" }, { "family_name": "Lim", "given_name": "Nancy F.", "clpid": "Lim-Nancy-F" }, { "family_name": "Kofuji", "given_name": "Paulo", "clpid": "Kofuji-P" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The voltage-, time-, and K^+-dependent properties of a G protein-activated inwardly rectifying K^+ channel (GIRK1/KGA/Kir3.1) cloned from rat atrium were studied in Xenopus oocytes under two-electrode voltage clamp. During maintained G protein activation and in the presence of high external K^+ (V_K = 0 mV), voltage jumps from V_K to negative membrane potentials activated inward GIRK1 K^+ currents with three distinct time-resolved current components. GIRK1 current activation consisted of an instantaneous component that was followed by two components with time constants T_f~50 ms and T_s~400 ms. These activation time constants were weakly voltage dependent, increasing approximately twofold with maximal hyperpolarization from V_K. Voltage-dependent GIRK1 availability, revealed by tail currents at -80 mV after long prepulses, was greatest at potentials negative to V_K and declined to a plateau of approximately half the maximal level at positive voltages. Voltage-dependent GIRK1 availability shifted with V_K and was half maximal at V_K -20 mV; the equivalent gating charge was ~1.6 e^-. The voltage-dependent gating parameters of GIRK1 did not significantly differ for G protein activation by three heterologously expressed signaling pathways: m2 muscarinic receptors, serotonin 1A receptors, or G protein \u03b21y2 subunits. Voltage dependence was also unaffected by agonist concentration. These results indicate that the voltage-dependent gating properties of GIRK1 are not due to extrinsic factors such as agonist-receptor interactions and G protein-channel coupling, but instead are analogous to the intrinsic gating behaviors of other inwardly rectifying K^+ channels.", "doi": "10.1085/jgp.106.1.1", "pmcid": "PMC2229253", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1995-07", "series_number": "1", "volume": "106", "issue": "1", "pages": "1-23" }, { "id": "authors:2e1ct-wc395", "collection": "authors", "collection_id": "2e1ct-wc395", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:COHjgp95", "type": "article", "title": "Regions of beta 2 and beta 4 responsible for differences between the steady state dose-response relationships of the alpha 3 beta 2 and alpha 3 beta 4 neuronal nicotinic receptors", "author": [ { "family_name": "Cohen", "given_name": "B. N.", "clpid": "Cohen-B-N" }, { "family_name": "Figl", "given_name": "A.", "clpid": "Figl-A" }, { "family_name": "Quick", "given_name": "M. W.", "clpid": "Quick-M-W" }, { "family_name": "Labarca", "given_name": "C.", "clpid": "Labarca-C" }, { "family_name": "Davidson", "given_name": "N.", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "H. A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "We constructed chimeras of the rat beta 2 and beta 4 neuronal nicotinic subunits to locate the regions that contribute to differences between the acetylcholine (ACh) dose-response relationships of the alpha 3 beta 2 and alpha 3 beta 4 receptors. Expressed in Xenopus oocytes, the alpha 3 beta 2 receptor displays an EC50 for ACh approximately 20-fold less than the EC50 of the alpha 3 beta 4 receptor. The apparent Hill slope (n(app)) of alpha 3 beta 2 is near one whereas the alpha 3 beta 4 receptor displays an n(app) near two. Substitutions within the first 120 residues convert the EC50 for ACh from one wild-type value to the other. Exchanging just beta 2:104-120 for the corresponding region of beta 4 shifts the EC50 of ACh dose-response relationship in the expected direction but does not completely convert the EC50 of the dose- response relationship from one wild-type value to the other. However, substitutions in the beta 2:104-120 region do account for the relative sensitivity of the alpha 3 beta 2 receptor to cytisine, tetramethylammonium, and ACh. The expression of beta 4-like (strong) cooperativity requires an extensive region of beta 4 (beta 4:1-301). Relatively short beta 2 substitutions (beta 2:104-120) can reduce cooperativity to beta 2-like values. The results suggest that amino acids within the first 120 residues of beta 2 and the corresponding region of beta 4 contribute to an agonist binding site that bridges the alpha and beta subunits in neuronal nicotinic receptors.", "doi": "10.1085/jgp.107.3.369", "pmcid": "PMC2216958", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1995-06", "series_number": "6", "volume": "105", "issue": "6", "pages": "745-764" }, { "id": "authors:ap0d7-0hy67", "collection": "authors", "collection_id": "ap0d7-0hy67", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20150120-140412390", "type": "article", "title": "Nicotinic Receptor Binding Site Probed with Unnatural Amino Acid Incorporation in Intact Cells", "author": [ { "family_name": "Nowak", "given_name": "Mark W.", "clpid": "Nowak-M-W" }, { "family_name": "Kearney", "given_name": "Patrick C.", "clpid": "Kearney-P-C" }, { "family_name": "Sampson", "given_name": "Jeffrey R.", "clpid": "Sampson-J-R" }, { "family_name": "Saks", "given_name": "Margaret E.", "clpid": "Saks-M-E" }, { "family_name": "Labarca", "given_name": "Cesar G.", "clpid": "Labarca-C-G" }, { "family_name": "Silverman", "given_name": "Scott K.", "clpid": "Silverman-S-K" }, { "family_name": "Zhong", "given_name": "Wenge", "clpid": "Zhong-Wenge" }, { "family_name": "Thorson", "given_name": "Jon", "clpid": "Thorson-J" }, { "family_name": "Abelson", "given_name": "John N.", "clpid": "Abelson-J-N" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Schultz", "given_name": "Peter G.", "clpid": "Schultz-P-G" }, { "family_name": "Dougherty", "given_name": "Dennis A.", "orcid": "0000-0003-1464-2461", "clpid": "Dougherty-D-A" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The nonsense codon suppression method for unnatural amino acid incorporation has been applied to intact cells and combined with electrophysiological analysis to probe structure-function relations in the nicotinic acetylcholine receptor. Functional receptors were expressed in Xenopus oocytes when tyrosine and phenylalanine derivatives were incorporated at positions 93, 190, and 198 in the binding site of the \u03b1 subunit. Subtle changes in the structure of an individual side chain produced readily detectable changes in the function of this large channel protein. At each position, distinct features of side chain structure dominated the dose-response relation, probably by governing the agonist-receptor binding.", "doi": "10.1126/science.7716551", "issn": "0036-8075", "publisher": "American Association for the Advancement of Science", "publication": "Science", "publication_date": "1995-04-21", "series_number": "5209", "volume": "268", "issue": "5209", "pages": "439-442" }, { "id": "authors:gvqyk-spn15", "collection": "authors", "collection_id": "gvqyk-spn15", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:LIMjgp95", "type": "article", "title": "A G protein-gated K channel is activated via beta 2-adrenergic receptors and G beta gamma subunits in Xenopus oocytes", "author": [ { "family_name": "Lim", "given_name": "Nancy Fidler", "clpid": "Lim-Nancy-Fidler" }, { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Labarca", "given_name": "Cesar", "clpid": "Labarca-C" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "In many tissues, inwardly rectifying K channels are coupled to seven- helix receptors via the Gi/Go family of heterotrimeric G proteins. This activation proceeds at least partially via G beta gamma subunits. These experiments test the hypothesis that G beta gamma subunits activate the channel even if released from other classes of heterotrimeric G proteins. The G protein-gated K channel from rat atrium, KGA/GIRK1, was expressed in Xenopus oocytes with various receptors and G proteins. The beta 2-adrenergic receptor (beta 2AR), a Gs-linked receptor, activated large KGA currents when the alpha subunit, G alpha s, was also overexpressed. Although G alpha s augmented the coupling between beta 2AR and KGA, G alpha s also inhibited the basal, agonist-independent activity of KGA. KGA currents stimulated via beta 2AR activated, deactivated, and desensitized more slowly than currents stimulated via Gi/Go-linked receptors. There was partial occlusion between currents stimulated via beta 2AR and the m2 muscarinic receptor (a Gi/Go-linked receptor), indicating some convergence in the mechanism of activation by these two receptors. Although stimulation of beta 2AR also activates adenylyl cyclase and protein kinase A, activation of KGA via beta 2AR is not mediated by this second messenger pathway, because direct elevation of intracellular cAMP levels had no effect on KGA currents. Experiments with other coexpressed G protein alpha and beta gamma subunits showed that (a) a constitutively active G alpha s mutant did not suppress basal KGA currents and was only partially as effective as wild type G alpha s in coupling beta 2AR to KGA, and (b) beta gamma subunits increased basal KGA currents. These results reinforce present concepts that beta gamma subunits activate KGA, and also suggest that beta gamma subunits may provide a link between KGA and receptors not previously known to couple to inward rectifiers.", "doi": "10.1085/jgp.105.3.421", "pmcid": "PMC2216943", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1995-03", "series_number": "3", "volume": "105", "issue": "3", "pages": "421-439" }, { "id": "authors:cjaee-c9b24", "collection": "authors", "collection_id": "cjaee-c9b24", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:QUIjbc94", "type": "article", "title": "Differential coupling of G protein alpha subunits to seven-helix receptors expressed in Xenopus oocytes", "author": [ { "family_name": "Quick", "given_name": "Michael W.", "clpid": "Quick-M-W" }, { "family_name": "Simon", "given_name": "Melvin I.", "clpid": "Simon-M-I" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Aragay", "given_name": "Anna M.", "clpid": "Aragay-A-M" } ], "abstract": "Xenopus oocytes were used to examine the coupling of the serotonin 1c (5HT1c) and thyrotropin-releasing hormone (TRH) receptors to both endogenous and heterologously expressed G protein alpha subunits. Expression of either G protein-coupled receptor resulted in agonist- induced, Ca(2+)-activated Cl- currents that were measured using a two- electrode voltage clamp. 5HT-induced Cl- currents were reduced 80% by incubating the injected oocytes with pertussis toxin (PTX) and inhibited 50-65% by injection of antisense oligonucleotides to the PTX- sensitive Go alpha subunit. TRH-induced Cl- currents were reduced only 20% by PTX treatment but were inhibited 60% by injection of antisense oligonucleotides to the PTX-insensitive Gq alpha subunit. Injection of antisense oligonucleotides to a novel Xenopus phospholipase C-beta inhibited the 5HT1c (and Go)-induced Cl- current with little effect on the TRH (and Gq)-induced current. These results suggest that receptor- activated Go and Gq interact with different effectors, most likely different isoforms of phospholipase C-beta. Co-expression of each receptor with seven different mammalian G protein alpha subunit cRNAs (Goa, Gob, Gq, G11, Gs, Golf, and Gt) was also examined. Co-expression of either receptor with the first four of these G alpha subunits resulted in a maximum 4-6-fold increase in Cl- currents; the increase depended on the amount of G alpha subunit cRNA injected. This increase was blocked by PTX for G alpha oa and G alpha ob co-expression but not for G alpha q or G alpha 11 co-expression. Co-expression of either receptor with Gs, Golf, or Gt had no effect on Ca(2+)-activated Cl- currents; furthermore, co-expression with Gs or Golf also failed to reveal 5HT- or TRH-induced changes in adenylyl cyclase as assessed by activation of the cystic fibrosis transmembrane conductance regulator Cl- channel. These results indicate that in oocytes, the 5HT1c and TRH receptors do the following: 1) preferentially couple to PTX-sensitive (Go) and PTX-insensitive (Gq) G proteins and that these G proteins act on different effectors, 2) couple within the same cell type to several different heterologously expressed G protein alpha subunits to activate the oocyte's endogenous Cl- current, and 3) fail to couple to G protein alpha subunits that activate cAMP or phosphodiesterase.", "issn": "0021-9258", "publisher": "American Society for Biochemistry and Molecular Biology", "publication": "Journal of Biological Chemistry", "publication_date": "1994-12-02", "series_number": "48", "volume": "269", "issue": "48", "pages": "30164-30172" }, { "id": "authors:wea8w-cgv25", "collection": "authors", "collection_id": "wea8w-cgv25", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:BRApnas94", "type": "article", "title": "Heteromeric olfactory cyclic nucleotide-gated channels: a subunit that confers increased sensitivity to cAMP", "author": [ { "family_name": "Bradley", "given_name": "Jonathan", "clpid": "Bradley-J" }, { "family_name": "Li", "given_name": "Jun", "clpid": "Li-Jun" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Zinn", "given_name": "Kai", "orcid": "0000-0002-6706-5605", "clpid": "Zinn-K" } ], "abstract": "Olfactory receptor neurons respond to odorant stimulation with a rapid increase in intracellular cAMP that opens cyclic nucleotide-gated (cng) cation channels. cng channels in rat olfactory neurons are activated by cAMP in the low micromolar range and are outwardly rectifying. The cloned rat olfactory cng channel (rOCNC1), however, is much less sensitive to cAMP and exhibits very weak rectification. Here we describe the cloning and characterization of a second rat cng channel subunit, denoted rOCNC2. rOCNC2 does not form functional channels when expressed alone. When rOCNC1 and rOCNC2 are coexpressed, however, an outwardly rectifying cation conductance with cAMP sensitivity near that of the native channel is observed. In situ hybridization with probes specific for the two subunits shows that they are coexpressed in olfactory receptor neurons. These data indicate that the native olfactory cng channel is likely to be a heterooligomer of the rOCNC1 and rOCNC2 subunits.", "pmcid": "PMC44712", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1994-09-13", "series_number": "19", "volume": "91", "issue": "19", "pages": "8890-8894" }, { "id": "authors:8vrh5-tyb81", "collection": "authors", "collection_id": "8vrh5-tyb81", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20170408-205029469", "type": "article", "title": "Distribution and localization of a G protein-coupled inwardly rectifying K\u207a channel in the rat", "author": [ { "family_name": "Karschin", "given_name": "Christine", "clpid": "Karschin-C" }, { "family_name": "Schreibmayer", "given_name": "Wolfgang", "clpid": "Schreibmayer-W" }, { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Lester", "given_name": "Henry", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Karschin", "given_name": "Andreas", "clpid": "Karschin-A" } ], "abstract": "The cellular distribution of the mRNA of the inwardly rectifying K^+ channel KGA (GIRK1) was investigated in rat tissue by in situ hybridization. KGA was originally cloned from the heart and represents the first G protein\u2010activated K^+ channel identified. It is expressed in peripheral tissue solely in the atrium, but not in the ventricle, skeletal muscle, lung and kidney. In the central nervous system KGA is most prominently expressed in the Ammon's horn and dentate gyrus of the hippocampus, neocortical layers II\u2013VI, cerebellar granular layer, olfactory bulb, anterior pituitary, thalamic nuclei and several distinct nuclei of the lower brainstem. The abundant expression of KGA in many CNS neurons support its important role as a major target channel for G protein mediated receptor function.", "doi": "10.1016/0014-5793(94)00590-7", "issn": "0014-5793", "publisher": "Wiley", "publication": "FEBS Letters", "publication_date": "1994-07-11", "series_number": "2", "volume": "348", "issue": "2", "pages": "139-144" }, { "id": "authors:x3nkn-7e556", "collection": "authors", "collection_id": "x3nkn-7e556", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:CORjbc94", "type": "article", "title": "Protein kinase C modulates the activity of a cloned gamma-aminobutyric acid transporter expressed in Xenopus oocytes via regulated subcellular redistribution of the transporter", "author": [ { "family_name": "Corey", "given_name": "Janis L.", "clpid": "Corey-J-L" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Brecha", "given_name": "Nicholas", "clpid": "Brecha-N" }, { "family_name": "Quick", "given_name": "Michael W.", "clpid": "Quick-M-W" } ], "abstract": "We report that activators and inhibitors of protein kinase C (PKC) and protein phosphatases regulate the activity of a cloned rat brain gamma- aminobutyric acid (GABA) transporter (GAT1) expressed in Xenopus oocytes. Four compounds known to activate PKC increased GABA uptake 2- 3.5-fold over basal control levels. Inhibition of PKC by bisindolylmaleimide reduced basal GABA uptake 80% and blocked the phorbol 12-myristate 13-acetate (PMA)-induced stimulation of transport. Okadaic acid, a protein phosphatase inhibitor, stimulated transport 2.5- fold; a 4-fold increase in GABA uptake occurred when oocytes were treated with cyclosporin A, a specific inhibitor of protein phosphatase 2B. Modulation resulted in changes to Vmax but not to Km and was influenced by the functional expression level of the transporter protein; as expression level increased, the ability to up-regulate transporter activity decreased. Down-regulation of transporter activity was independent of expression level. Modulation did not occur through phosphorylation of the three consensus PKC sites predicted by the primary protein sequence since their removal had no effect on the susceptibility of the transporter to modulation by PMA or bisindolylmaleimide. Subcellular fractionation of oocyte membranes demonstrated that under basal level conditions, the majority of GAT1 was targeted to a cytoplasmic compartment corresponding to the trans- Golgi or low density vesicles. Stimulation of PKC with PMA resulted in a translocation of transporters from this compartment to the plasma membrane. At higher expression levels of GAT1 protein, a larger portion of GAT1 was found on the plasma membrane during basal level conditions and treatment with bisindolylmaleimide resulted in removal of these transporters from the plasma membrane. At expression levels demonstrated to be resistant to modulation by PMA, PMA-treatment still resulted in translocation of transporters from the cytoplasm to the plasma membrane. Thus, the inability of PMA to increase uptake at high expression of the GAT1 protein is due to saturation at a step subsequent to translocation. These findings 1) demonstrate the presence of a novel regulated secretory pathway in oocytes and 2) suggest a modulatory mechanism for neurotransmitter transporters that could have significant effects upon synaptic function.", "issn": "0021-9258", "publisher": "American Society for Biochemistry and Molecular Biology", "publication": "Journal of Biological Chemistry", "publication_date": "1994-05-20", "series_number": "20", "volume": "269", "issue": "20", "pages": "14759-14767" }, { "id": "authors:d7t6y-s1x82", "collection": "authors", "collection_id": "d7t6y-s1x82", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20141210-095231086", "type": "article", "title": "A cocaine-sensitive Drosophila serotonin transporter: Cloning, expression, and electrophysiological characterization", "author": [ { "family_name": "Corey", "given_name": "Janis L.", "clpid": "Corey-J-L" }, { "family_name": "Quick", "given_name": "Michael W.", "clpid": "Quick-M-W" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Guastella", "given_name": "John", "clpid": "Guastella-J" } ], "abstract": "A cocaine-sensitive, high-affinity Drosophila serotonin (5-hydroxytryptamine; 5HT) transporter cDNA, denoted dSERT1, was isolated and characterized in oocytes. dSERT1 shows little transport of other monoamines and is Na^+ and Cl^- dependent. Sequence analysis indicates 12 putative transmembrane domains and strong homologies (\u224850%) among dSERT1 and mammalian 5HT, norepinephrine, and dopamine transporters. Interestingly, the pharmacological properties of dSERT1, including sensitivity to antidepressants, are more similar to those of mammalian catecholamine transporters than to mammalian 5HT transporters. Two-electrode voltage-clamp analysis demonstrated 5HT-induced, voltage-dependent currents. Cloning and characterization of dSERT1 adds significantly to our knowledge of the diversity of 5HT transporters with regard to primary sequence, pharmacological profile, and permeation properties.", "pmcid": "PMC521479", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1994-02-01", "series_number": "3", "volume": "91", "issue": "3", "pages": "1188-1192" }, { "id": "authors:ef303-m9a68", "collection": "authors", "collection_id": "ef303-m9a68", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:DASpnas93b", "type": "article", "title": "Atrial G protein-activated K+ channel: expression cloning and molecular properties", "author": [ { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Schreibmayer", "given_name": "Wolfgang", "clpid": "Schreibmayer-W" }, { "family_name": "Lim", "given_name": "Nancy F.", "clpid": "Lim-Nancy-F" }, { "family_name": "Wang", "given_name": "Weizhen", "clpid": "Wang-Weizhen" }, { "family_name": "Chavkin", "given_name": "Charles", "clpid": "Chavkin-C" }, { "family_name": "DiMagno", "given_name": "Lisa", "clpid": "DiMagno-L" }, { "family_name": "Labarca", "given_name": "Cesar", "clpid": "Labarca-C" }, { "family_name": "Kieffer", "given_name": "Brigitte L.", "clpid": "Kieffer-B-L" }, { "family_name": "Gaveriaux-Ruff", "given_name": "Claire", "clpid": "Gaveriaux-Ruff-C" }, { "family_name": "Trollinger", "given_name": "David", "clpid": "Trollinger-D" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Activity of several ion channels is controlled by heterotrimeric GTP-binding proteins (G proteins) via a membrane-delimited pathway that does not involve cytoplasmic intermediates. The best studied example is the K+ channel activated by muscarinic agonists in the atrium, which plays a crucial role in regulating the heartbeat. To enable studies of the molecular mechanisms of activation, this channel, denoted KGA, was cloned from a rat atrium cDNA library by functional coupling to coexpressed serotonin type 1A receptors in Xenopus oocytes. KGA displays regions of sequence homology to other inwardly rectifying channels as well as unique regions that may govern G-protein interaction. The expressed KGA channel is activated by serotonin 1A, muscarinic m2, and delta-opioid receptors via G proteins. KGA is activated by guanosine 5'-[gamma-thio]triphosphate in excised patches, confirming activation by a membrane-delimited pathway, and displays a conductance equal to that of the endogenous channel in atrial cells. The hypothesis that similar channels play a role in neuronal inhibition is supported by the cloning of a nearly identical channel (KGB1) from a rat brain cDNA library.", "doi": "10.1073/pnas.90.21.10235", "pmcid": "PMC47749", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1993-11-01", "series_number": "21", "volume": "90", "issue": "21", "pages": "10235-10239" }, { "id": "authors:mjzmn-yx925", "collection": "authors", "collection_id": "mjzmn-yx925", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120307-154341054", "type": "article", "title": "Random Mutagenesis of G protein \u0251 Subunit G_o\u0251. Mutations altering nucleotide binding", "author": [ { "family_name": "Slepak", "given_name": "Vladlen Z.", "clpid": "Slepak-V-Z" }, { "family_name": "Quick", "given_name": "Michael W.", "clpid": "Quick-M-W" }, { "family_name": "Aragay", "given_name": "Anna M.", "clpid": "Aragay-A-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Simon", "given_name": "Melvin I.", "clpid": "Simon-M-I" } ], "abstract": "Nucleotide binding properties of the G protein \u0251 subunit G_o\u0251 were probed by mutational analysis in recombinant Escherichia coli. Thousands of random mutations generated by polymerase chain reaction were screened by in situ [^(35)S]GTPyS (guanosine 5'-(3-O-thio)-triphosphate) binding on the colony lifts following transformation of bacteria with modified G_o\u0251 cDNA. Clones that did not bind the nucleotide under these conditions were characterized by DNA sequence analysis, and the nucleotide binding properties were further studied in crude bacterial extracts. A number of novel mutations reducing the affinity of G_o\u0251 for GTPyS or Mg^(2+) were identified. Some of the mutations substitute amino acid residues homologous to those known to interact with guanine nucleotides in p21^(ras) proteins. Other mutations show that previously unstudied residues also participate in the nucleotide binding. Several mutants lost GTPyS binding but retained the capacity to interact with the \u03b2y subunit complex as determined by pertussis toxin-mediated ADP-ribosylation. One of these, mutant S47C, was functionally expressed in Xenopus laevis oocytes along with the G protein-coupled thyrotropin-releasing hormone (TRH) receptor. Whereas wild-type G_o\u0251 increased TRH-promoted chloride currents, S47C significantly decreased the hormone-induced Cl^- response, suggesting that this mutation resulted in a dominant negative phenotype.", "issn": "0021-9258", "publisher": "American Society for Biochemistry and Molecular Biology", "publication": "Journal of Biological Chemistry", "publication_date": "1993-10-15", "series_number": "29", "volume": "268", "issue": "29", "pages": "21889-21894" }, { "id": "authors:7nsa0-14487", "collection": "authors", "collection_id": "7nsa0-14487", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:DASpnas93", "type": "article", "title": "Expression of an atrial G-protein-activated potassium channel in Xenopus oocytes", "author": [ { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Lim", "given_name": "Nancy F.", "clpid": "Lim-Nancy-F" }, { "family_name": "Schreibmayer", "given_name": "Wolfgang", "clpid": "Schreibmayer-W" }, { "family_name": "Wang", "given_name": "Weizhen", "clpid": "Wang-Weizhen" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Injection of rat atrial RNA into Xenopus oocytes resulted in the expression of a guanine nucleotide binding (G) protein-activated K+ channel. Current through the channel could be activated by acetylcholine or, if RNA encoding a neuronal 5HT1A receptor was coinjected with atrial RNA, by serotonin (5HT). A 5HT-evoked current (I5HT) was observed in oocytes injected with ventricle RNA fractions (of 2.5-5.5 kb) and 5HT1A receptor RNA. I5HT displayed strong inward rectification with very little conductance above the K+ equilibrium potential, was highly selective for K+ over Na+, and was blocked by 5-300 \u00b5M Ba2+. I5HT was suppressed by intracellular injection of the nonhydrolyzable analog of GDP, guanosine 5'-[\u00df-thio]diphosphate, but not by treatment with pertussis toxin (PTX), suggesting coupling of the receptor to the G-protein-activated K+ channel via a PTX-insensitive G protein, possibly endogenously present in the oocyte. Coexpression of the subunit of a PTX-sensitive G protein, Gi2, rendered I5HT sensitive to PTX inhibition. Native oocytes displayed a constitutively active inwardly rectifying K+ current with a lower sensitivity to Ba2+ block; expression of a similar current was also directed by atrial or ventricle RNA of 1.5-3 kb. Xenopus oocytes may be employed for cloning of the G-protein-activated K+ channel cDNA and for studying the coupling between this channel and G proteins.", "doi": "10.1073/pnas.90.14.6596", "pmcid": "PMC46979", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1993-07-15", "series_number": "14", "volume": "90", "issue": "14", "pages": "6596-6600" }, { "id": "authors:zn4rp-png14", "collection": "authors", "collection_id": "zn4rp-png14", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120309-113518954", "type": "article", "title": "Voltage-dependent Block of the Cystic Fibrosis Transmembrane Conductance Regulator Cl- Channel by Two Closely\n Related Arylaminobenzoates", "author": [ { "family_name": "McCarthy", "given_name": "N. A.", "clpid": "McCarthy-N-A" }, { "family_name": "McDonough", "given_name": "S.", "clpid": "McDonough-S" }, { "family_name": "Cohen", "given_name": "B. N.", "clpid": "Cohen-B-N" }, { "family_name": "Riordan", "given_name": "J. R.", "clpid": "Riordan-J-R" }, { "family_name": "Davidson", "given_name": "N.", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "H. A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The gene defective in cystic fibrosis encodes a Cl- channel, the cystic fibrosis transmembrane conductance regulator (CFTR). CFTR is blocked by diphenylamine-2-carboxylate (DPC) when applied extracellularly at millimolar concentrations. We studied the block of CFTR expressed in Xenopus oocytes by DPC or by a closely related molecule, flufenamic acid (FFA). Block of whole-cell CFTR currents by bath-applied DPC or by FFA, both at 200 \u00b5M, requires several minutes to reach full effect. Blockade is voltage dependent, suggesting open-channel block: currents at positive potentials are not affected but currents at negative potentials are reduced. The binding site for both drugs senses ~40% of the electric field across the membrane, measured from the inside. In single-channel recordings from excised patches without blockers, the conductance was 8.0 \u00b1 0.4 pS in symmetric 150 mM Cl^-. A subconductance state, measuring ~60% of the main conductance, was often observed. Bursts to the full open state lasting up to tens of seconds were uninterrupted at depolarizing membrane voltages. At hyperpolarizing voltages, bursts were interrupted by brief closures. Either DPC or FFA (50 \u00b5M) applied to the cytoplasmic or extracellular face of the channel led to an increase in flicker at V_m =-100 mV and not at V_m = +100 mV, in agreement with whole-cell experiments. DPC induced a higher frequency of flickers from the cytoplasmic side than the extracellular side. FFA produced longer closures than DPC; the FFA closed time was roughly equal (~ 1.2 ms) at -100 mV with application from either side. In cell-attached patch recordings with DPC or FFA applied to the bath, there was flickery block at V_m = -100 mV, confirming that the drugs permeate through the membrane to reach the binding site. The data are consistent with the presence of a single binding site for both drugs, reached from either end of the channel. Open-channel block by DPC or FFA may offer tools for use with site-directed mutagenesis to describe the permeation pathway.", "doi": "10.1085/jgp.102.1.1", "pmcid": "PMC2229162", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1993-07", "series_number": "1", "volume": "102", "issue": "1", "pages": "1-23" }, { "id": "authors:8ff06-07074", "collection": "authors", "collection_id": "8ff06-07074", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20151217-104726852", "type": "article", "title": "Receptors that couple to 2 classes of G proteins increase cAMP and activate CFTR expressed in Xenopus oocytes", "author": [ { "family_name": "Uezono", "given_name": "Y.", "clpid": "Uezono-Y" }, { "family_name": "Bradley", "given_name": "J.", "clpid": "Bradley-J" }, { "family_name": "Min", "given_name": "C.", "clpid": "Min-C" }, { "family_name": "McCarty", "given_name": "N. A.", "clpid": "McCarty-N-A" }, { "family_name": "Quick", "given_name": "M.", "clpid": "Quick-M-W" }, { "family_name": "Riordan", "given_name": "J. R.", "clpid": "Riordan-J-R" }, { "family_name": "Chavkin", "given_name": "C.", "clpid": "Chavkin-C" }, { "family_name": "Zinn", "given_name": "K.", "orcid": "0000-0002-6706-5605", "clpid": "Zinn-K" }, { "family_name": "Lester", "given_name": "H. A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "N.", "clpid": "Davidson-N-R" } ], "abstract": "The cystic fibrosis transmembrane conductance regulator (CFTR), a Cl- channel activated by phosphorylation, was expressed in Xenopus oocytes along with various combinations of several other components of the cAMP signalling pathway. Activation of the coexpressed beta 2 adrenergic receptor increased cAMP and led to CFTR activation. The activation of CFTR (1) requires only short (15 s) exposure to isoproterenol, (2) occurs for agonist concentrations 100-1000 fold lower than those that produce cAMP increases detectable by a radioimmunoassay, (3) requires injection of only 5 pg of receptor cRNA per oocyte, and (4) can be increased further by coexpression of cRNA for adenylyl cyclase type II or III or for Gs alpha. In addition, CFTR activation and cAMP increases by beta 2 activation were enhanced by activation of the coexpressed 5HT1A receptor, which is thought to couple to Gi. The additional activation by the 5HT1A receptor was enhanced by coexpression of adenylyl cyclase type II but not with type III and may proceed via the beta gamma subunits of a G protein. The sensitivity of the assay system is also demonstrated by responses to vasoactive intestinal peptide and to pituitary adenylate cyclase-activating polypeptide in oocytes injected with cerebral cortex mRNA.", "issn": "1060-6823", "publisher": "Harwood Academic", "publication": "Receptors & Channels", "publication_date": "1993", "series_number": "3", "volume": "1", "issue": "3", "pages": "233-241" }, { "id": "authors:336nq-b5381", "collection": "authors", "collection_id": "336nq-b5381", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:COHjgp92a", "type": "article", "title": "Mutations in M2 alter the selectivity of the mouse nicotinic acetylcholine receptor for organic and alkali metal cations", "author": [ { "family_name": "Cohen", "given_name": "Bruce N.", "clpid": "Cohen-B-N" }, { "family_name": "Labarca", "given_name": "Cesar", "clpid": "Labarca-C" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "We measured the permeability ratios (PX/PNa) of 3 wild-type, 1 hybrid, 2 subunit-deficient, and 22 mutant nicotinic receptors expressed in Xenopus oocytes for alkali metal and organic cations using shifts in the bi-ionic reversal potential of the macroscopic current. Mutations at three positions (2', 6', 10') in M2 affected ion selectivity. Mutations at position 2' (alpha Thr244, beta Gly255, gamma Thr253, delta Ser258) near the intracellular end of M2 changed the organic cation permeability ratios as much as twofold and reduced PCs/PNa and PK/PNa by 16-18%. Mutations at positions 6' and 10' increased the glycine ethyl ester/Na+ and glycine methyl ester/Na+ permeability ratios. Two subunit alterations also affected selectivity: omission of the delta subunit reduced PCs/PNa by 16%, and substitution of Xenopus delta for mouse delta increased Pguanidinium/PNa more than twofold and reduced PCs/PNa by 34% and PLi/PNa by 20%. The wild-type mouse receptor displayed a surprising interaction with the primary ammonium cations; relative permeability peaked at a chain length equal to four carbons. Analysis of the organic permeability ratios for the wild-type mouse receptor shows that (a) the diameter of the narrowest part of the pore is 8.4 A; (b) the mouse receptor departs significantly from size selectivity for monovalent organic cations; and (c) lowering the temperature reduces Pguanidinium/PNa by 38% and Pbutylammonium/PNa more than twofold. The results reinforce present views that positions -1' and 2' are the narrowest part of the pore and suggest that positions 6' and 10' align some permeant organic cations in the pore in an interaction similar to that with channel blocker, QX-222.", "doi": "10.1085/jgp.100.3.373", "pmcid": "PMC2229089", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1992-09", "series_number": "3", "volume": "100", "issue": "3", "pages": "373-400" }, { "id": "authors:4f9gz-skc95", "collection": "authors", "collection_id": "4f9gz-skc95", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:GUApnas92", "type": "article", "title": "Cloning, expression, and localization of a rat brain high-affinity glycine transporter", "author": [ { "family_name": "Guastella", "given_name": "John", "clpid": "Guastella-J" }, { "family_name": "Brecha", "given_name": "Nicholas", "clpid": "Brecha-N" }, { "family_name": "Weigmann", "given_name": "Christine", "clpid": "Weigmann-C" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A cDNA clone encoding a glycine transporter has been isolated from rat brain by a combined PCR and plaque-hybridization strategy. mRNA synthesized from this clone (designated GLYT1) directs the expression of sodium-and chloride-dependent, high-affinity uptake of [3H]glycine by Xenopus oocytes. [3H]Glycine transport mediated by clone GLYT1 is blocked by sarcosine but is not blocked by methylaminoisobutyric acid or L-alanine, a substrate specificity similar to that described for a previously identified glycine-uptake system called system Gly. In situ hybridization reveals that GLYT1 is prominently expressed in the cervical spinal cord and brainstem, two regions of the central nervous system where glycine is a putative neurotransmitter. GLYT1 is also strongly expressed in the cerebellum and olfactory bulb and is expressed at lower levels in other brain regions. The open reading frame of the GLYT1 cDNA predicts a protein containing 633 amino acids with a molecular mass of \u224870 kDa. The primary structure and hydropathicity profile of GLYT1 protein reveal that this protein is a member of the sodium- and chloride-dependent superfamily of transporters that utilize neurotransmitters and related substances as substrates.", "doi": "10.1073/pnas.89.15.7189", "pmcid": "PMC49671", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1992-08-01", "series_number": "15", "volume": "89", "issue": "15", "pages": "7189-7193" }, { "id": "authors:2saaf-42t80", "collection": "authors", "collection_id": "2saaf-42t80", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:COHjgp92b", "type": "article", "title": "Tris+/Na+ permeability ratios of nicotinic acetylcholine receptors are reduced by mutations near the intracellular end of the M2 region", "author": [ { "family_name": "Cohen", "given_name": "Bruce N.", "clpid": "Cohen-B-N" }, { "family_name": "Labarca", "given_name": "Cesar", "clpid": "Labarca-C" }, { "family_name": "Czyzyk", "given_name": "Linda", "clpid": "Czyzyk-L" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Tris+/Na+ permeability ratios were measured from shifts in the biionic reversal potentials of the macroscopic ACh-induced currents for 3 wild- type (WT), 1 hybrid, 2 subunit-deficient, and 25 mutant nicotinic receptors expressed in Xenopus oocytes. At two positions near the putative intracellular end of M2, 2' (alpha Thr244, beta Gly255, gamma Thr253, delta Ser258) and -1', point mutations reduced the relative Tris+ permeability of the mouse receptor as much as threefold. Comparable mutations at several other positions had no effects on relative Tris+ permeability. Mutations in delta had a greater effect on relative Tris+ permeability than did comparable mutations in gamma; omission of the mouse delta subunit (delta 0 receptor) or replacement of mouse delta with Xenopus delta dramatically reduced relative Tris+ permeability. The WT mouse muscle receptor (alpha beta gamma delta) had a higher relative permeability to Tris+ than the wild-type Torpedo receptor. Analysis of the data show that (a) changes in the Tris+/Na+ permeability ratio produced by mutations correlate better with the hydrophobicity of the amino acid residues in M2 than with their volume; and (b) the mole-fraction dependence of the reversal potential in mixed Na+/Tris+ solutions is approximately consistent with the Goldman- Hodgkin-Katz voltage equation. The results suggest that the main ion selectivity filter for large monovalent cations in the ACh receptor channel is the region delimited by positions -1' and 2' near the intracellular end of the M2 helix.", "doi": "10.1085/jgp.99.4.545", "pmcid": "PMC2219204", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1992-04", "series_number": "4", "volume": "99", "issue": "4", "pages": "545-572" }, { "id": "authors:36rr0-zqx49", "collection": "authors", "collection_id": "36rr0-zqx49", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20191101-161058438", "type": "article", "title": "Cell-specific posttranslational events affect functional expression at the plasma membrane but not tetrodotoxin sensitivity of the rat brain IIA sodium channel \u03b1-subunit expressed in mammalian cells", "author": [ { "family_name": "Yang", "given_name": "Xian-cheng", "clpid": "Yang-Xian-cheng" }, { "family_name": "Labarca", "given_name": "Cesar", "clpid": "Labarca-Cesar" }, { "family_name": "Nargeot", "given_name": "Joel", "clpid": "Nargeot-Joel" }, { "family_name": "Ho", "given_name": "Begonia Y.", "clpid": "Ho-Begonia-Y" }, { "family_name": "Elroy-Stein", "given_name": "Orna", "clpid": "Elroy-Stein-Orna" }, { "family_name": "Moss", "given_name": "Bernard", "clpid": "Moss-Bernard" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The rat brain IIA Na\u207a channel alpha-subunit was expressed and studied in mammalian cells. Cells were infected with a recombinant vaccinia virus (VV) carrying the bacteriophage T7 RNA polymerase gene and were transfected with cDNA encoding the IIA Na\u207a channel \u03b1-subunit under control of a T7 promoter. Whole-cell patch-clamp recording showed that functional IIA channels were expressed efficiently (~10 channels/ \u00b5m\u00b2 in approximately 60% of cells) in Chinese hamster ovary (CHO) cells and in neonatal rat ventricular myocytes but were expressed poorly in undifferentiated BC\u2083H1 cells and failed to express in Ltk\u207b cells. However, voltage-dependent Drosophila Shaker H4 K\u207a channels and Escherichia coli \u03b2-galactosidase were expressed efficiently in all four cell types with VV vectors. Because RNA synthesis probably occurs without major differences in the cytoplasm of all infected cell types under the control of the T7 promoter and T7 polymerase, we conclude that cell type-specific expression of the Na\u207a channel probably reflects differences at posttranslational steps. The gating properties of the IIA Na\u207a currents expressed in cardiac myocytes differed from those expressed in CHO cells; most noticeably, the IIA Na\u207a currents displayed more rapid macroscopic inactivation when expressed in cardiac myocytes. These differences also suggest cell- specific posttranslational modifications. IIA channels were blocked by ~90% by 90 nM TTX when expressed either in CHO cells or in cardiac myocytes; the latter also continued to display endogenous TTX- resistant Na\u207a currents. Therefore, the TTX binding site of the channel is not affected by cell-specific modifications and is encoded by the primary amino acid sequence.", "doi": "10.1523/jneurosci.12-01-00268.1992", "pmcid": "PMC6575683", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "1992-01-01", "series_number": "1", "volume": "12", "issue": "1", "pages": "268-277" }, { "id": "authors:c035w-q0r76", "collection": "authors", "collection_id": "c035w-q0r76", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120420-071637268", "type": "article", "title": "Low Molecular Weight mRNA Encodes a Protein That Controls Serotonin 5-HT_(1c) and Acetylcholine M_1 Receptor Sensitivity\n in Xenopus Oocytes", "author": [ { "family_name": "Walter", "given_name": "A. E.", "clpid": "Walter-A-E" }, { "family_name": "Hoger", "given_name": "J. H.", "clpid": "Hoger-J-H" }, { "family_name": "Labarca", "given_name": "C.", "clpid": "Labarca-C" }, { "family_name": "Yu", "given_name": "L.", "clpid": "Yu-L" }, { "family_name": "Davidson", "given_name": "N.", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "H. A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Serotonin 5-HT_(1c) and acetylcholine M_1 receptors activate phosphoinositidase, resulting in an increased formation of IP_3 and 1,2 diacylglycerol. In Xenopus oocytes injected with mRNA encoding either of these receptors, Ca^(2+) released from intracellular stores in response to IP3 then opens Ca^(2+)-gated Cl^-channels. In the present experiments, oocytes expressing a transcript from a cloned mouse serotonin 5-HT_(1c) receptor were exposed to identical 15-s pulses of agonist, administered 2 min apart; the second current response was two to three times that of the first. However, in those oocytes coinjected with the 5-HT_(1c) receptor transcript and a low molecular weight fraction (0.3-1.5 kb) of rat brain mRNA, the second current response was ~50% of the first. Thus, the low molecular weight RNA encodes a protein (or proteins) that causes desensitization. Experiments using fura-2 or a Ca^(2+)-free superfusate indicated that desensitization of the 5-HT_(1c) receptor response does not result from a sustained elevation of intracellular Ca^(2+) level or require the entry of extracellular Ca^(2+). Photolysis of caged IP_3 demonstrated that an increase in IP_3 and a subsequent rise in Ca^(2+) do not produce desensitization of either the IP_3 or 5-HT_(1c) peak current responses. Furthermore, in oocytes coinjected with the low molecular weight RNA and a transcript from the rat M_1 acetylcholine receptor, the M_1 current response was greatly attenuated. Our data suggest that the proteins involved in attenuation of the M_1 current response and desensitization of the 5-HT_(1c) current response may be the same.", "doi": "10.1085/jgp.98.2.399", "pmcid": "PMC2229050", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1991-08", "series_number": "2", "volume": "98", "issue": "2", "pages": "399-417" }, { "id": "authors:aj9vt-deh94", "collection": "authors", "collection_id": "aj9vt-deh94", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:KARpnas91", "type": "article", "title": "Heterologously expressed serotonin 1A receptors couple to muscarinic K+ channels in heart", "author": [ { "family_name": "Karschin", "given_name": "Andreas", "clpid": "Karschin-A" }, { "family_name": "Ho", "given_name": "Begonia Y.", "clpid": "Ho-Begonia-Y" }, { "family_name": "Labarca", "given_name": "Cesar", "clpid": "Labarca-C" }, { "family_name": "Elroy-Stein", "given_name": "Orna", "clpid": "Elroy-Stein-O" }, { "family_name": "Moss", "given_name": "Bernard", "clpid": "Moss-B" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "In cardiac atrial cells, muscarinic acetylcholine receptors activate a K+ current directly via a guanine nucleotide-binding protein (G protein). Serotonin type 1A receptors may activate a similar pathway in hippocampal neurons. To develop a system in which receptor/G protein/K+ channel coupling can be experimentally manipulated, we have used a highly efficient recombinant vaccinia virus vector system to express human serotonin 1A receptors in primary cultures of rat atrial myocytes. The expressed 1A receptors activated the inwardly rectifying K+ conductance that is normally activated by the endogenous muscarinic acetylcholine receptors. Maximal responses to either agonist occluded further activation by the other agonist. The average activation time constants for serotonin were about 5 times slower than for acetylcholine. The data support suggestions that the intracellular signaling pathway from seven-helix receptors to G proteins and directly to ion channels is widespread in excitable cells. After a fraction of the G proteins are activated irreversibly by guanosine 5'-[\u03b3-thio]triphosphate, subsequent transduction proceeds more efficiently. One possible interpretation is that multiple G-protein molecules are required to activate each channel. Vaccinia virus expression vectors are thus useful for expressing seven-helix receptors in primary cultures of postmitotic cells and have provided a heterologous expression system for the signaling pathway from seven-helix receptors to G proteins and directly to ion channels.", "doi": "10.1073/pnas.88.13.5694", "pmcid": "PMC51944", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1991-07-15", "series_number": "13", "volume": "88", "issue": "13", "pages": "5694-5698" }, { "id": "authors:rmx1t-b4y57", "collection": "authors", "collection_id": "rmx1t-b4y57", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HUMmcb90", "type": "article", "title": "A combination of derepression of the lac operator-repressor system with positive induction by glucocorticoid and metal ions provides a high-level-inducible gene expression system based on the human metallothionein-IIA promoter", "author": [ { "family_name": "Hu", "given_name": "Mickey C.-T.", "clpid": "Hu-M-C-T" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We and others have introduced the use of the lac operator-repressor system as a method for providing inducible gene expression for gene transfer experiments in animal cells (M. C.-T. Hu, and N. Davidson, Cell 48:555-566, 1987; J. Figge, C. Wright, C. J. Collins, T. M. Roberts, and D. M. Livingston, Cell 52:713-722, 1988). To improve the dynamic range of such an inducible system, we have investigated the effects of combining the relief by isopropyl-beta-D-thiogalactoside (IPTG) of negative control by the lac system with positive induction by the natural inducers glucocorticoids and cadmium ion for a system based on the human metallothionein-IIA gene promoter. We used the chloramphenicol acetyltransferase gene as a reporter gene and inserted a lacO sequence into the promoter between the GC box and metal-responsive element 1, between metal-responsive element 1 and the TATA box, or between the TATA box and the transcription start site. Surprisingly, all of these insertions had a significant inhibitory effect on promoter activity even in the absence of repressor. However, with these lacO-containing constructs, the levels of gene expression after induction by glucocorticoid, Cd2+, or both were considerably reduced in cells engineered to express the lac repressor. Derepression by IPTG, coupled with induction by both dexamethasone and Cd2+ ion, then provided a high level of induced expression, i.e., by a factor of approximately 100 over the basal level of expression. However, inserting the lacO sequence well upstream just before the glucocorticoid-responsive element had much smaller effects on expression levels in both repressor-negative and repressor-positive cells. This study describes a new, high-level-inducible promoter system for gene transfer experiments. The observed effects are discussed in terms of current models of the mechanisms by which transcription factors control gene expression.", "issn": "0270-7306", "publisher": "Molecular and Cellular Biology", "publication": "Molecular and Cellular Biology", "publication_date": "1990-12-01", "series_number": "12", "volume": "10", "issue": "12", "pages": "6141-6151" }, { "id": "authors:cj9pd-z5t88", "collection": "authors", "collection_id": "cj9pd-z5t88", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:AHMnar90", "type": "article", "title": "Both sodium channel II and IIA alpha subunits are expressed in rat brain", "author": [ { "family_name": "Ahmed", "given_name": "C. M. lqbal", "clpid": "Ahmed-C-M-I" }, { "family_name": "Auld", "given_name": "Vanessa J.", "clpid": "Auld-V-J" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Dunn", "given_name": "Robert", "clpid": "Dunn-R-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Complementary DNAs encoding four distinct isoforms of the large (\u03b1) subunit of the voltage sensitive sodium channel have been isolated from rat brain mRNA (1,2,3). Two of these, II and HA, differ in only 36 nucleotides within the coding region and in only 6 amino acids (1, 3). Because of the possible functional significance of electrophysiological differences between isoforms, it is important to establish definitively that the sequence differences are not due to cloning artifacts and to estimate the relative prevalence levels of the two mRNAs in rat brain.", "doi": "10.1093/nar/18.19.5907", "pmcid": "PMC332354", "issn": "0305-1048", "publisher": "Oxford University Press", "publication": "Nucleic Acids Research", "publication_date": "1990-10-11", "series_number": "19", "volume": "18", "issue": "19", "pages": "5907-5907" }, { "id": "authors:phcjx-xks66", "collection": "authors", "collection_id": "phcjx-xks66", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:KRAjgp90", "type": "article", "title": "Inactivation of cloned Na channels expressed in Xenopus oocytes", "author": [ { "family_name": "Krafte", "given_name": "Douglas S.", "clpid": "Krafte-D-S" }, { "family_name": "Goldin", "given_name": "Alan L.", "clpid": "Goldin-A-L" }, { "family_name": "Auld", "given_name": "Vanessa J.", "clpid": "Auld-V-J" }, { "family_name": "Dunn", "given_name": "Robert J.", "clpid": "Dunn-R-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "This study investigates the inactivation properties of Na channels expressed in Xenopus oocytes from two rat IIA Na channel cDNA clones differing by a single amino acid residue. Although the two cDNAs encode Na channels with substantially different activation properties (Auld, V. J., A. L. Goldin, D. S. Krafte, J. Marshall, J. M. Dunn, W. A. Catterall, H. A. Lester, N. Davidson, and R. J. Dunn. 1988. Neuron. 1:449-461), their inactivation properties resemble each other strongly but differ markedly from channels induced by poly(A+) rat brain RNA. Rat IIA currents inactivate more slowly, recover from inactivation more slowly, and display a steady-state voltage dependence that is shifted to more positive potentials. The macroscopic inactivation process for poly(A+) Na channels is defined by a single exponential time course; that for rat IIA channels displays two exponential components. At the single-channel level these differences in inactivation occur because rat IIA channels reopen several times during a depolarizing pulse; poly(A+) channels do not. Repetitive stimulation (greater than 1 Hz) produces a marked decrement in the rat IIA peak current and changes the waveform of the currents. When low molecular weight RNA is coinjected with rat IIA RNA, these inactivation properties are restored to those that characterize poly(A+) channels. Slow inactivation is similar for rat IIA and poly(A+) channels, however. The data suggest that activation and inactivation involve at least partially distinct regions of the channel protein.", "doi": "10.1085/jgp.96.4.689", "pmcid": "PMC2229013", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1990-10", "series_number": "4", "volume": "96", "issue": "4", "pages": "689-706" }, { "id": "authors:smwpv-b5x55", "collection": "authors", "collection_id": "smwpv-b5x55", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20141222-150126708", "type": "article", "title": "Cloning and expression of a rat brain GABA transporter", "author": [ { "family_name": "Guastella", "given_name": "John", "clpid": "Guastella-John" }, { "family_name": "Nelson", "given_name": "Nathan", "clpid": "Nelson-Nathan" }, { "family_name": "Nelson", "given_name": "Hannah", "clpid": "Nelson-Hannah" }, { "family_name": "Czyzyk", "given_name": "Linda", "clpid": "Czyzyk-Linda" }, { "family_name": "Keynan", "given_name": "Shoshi", "clpid": "Keynan-Shoshi" }, { "family_name": "Miedel", "given_name": "May C.", "clpid": "Miedel-May-C" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Kanner", "given_name": "Baruch", "clpid": "Kanner-Baruch" } ], "abstract": "A complementary DNA clone (designated GAT-1) encoding a transporter for the neurotransmitter gamma-aminobutyric acid (GABA) has been isolated from rat brain, and its functional properties have been examined in Xenopus oocytes. Oocytes injected with GAT-1 synthetic messenger RNA accumulated [^3H]GABA to levels above control values. The transporter encoded by GAT-1 has a high affinity for GABA, is sodium-and chloride-dependent, and is pharmacologically similar to neuronal GABA transporters. The GAT-1 protein shares antigenic determinants with a native rat brain GABA transporter. The nucleotide sequence of GAT-1 predicts a protein of 599 amino acids with a molecular weight of 67 kilodaltons. Hydropathy analysis of the deduced protein suggests multiple transmembrane regions, a feature shared by several cloned transporters; however, database searches indicate that GAT-1 is not homologous to any previously identified proteins. Therefore, GAT-1 appears to be a member of a previously uncharacterized family of transport molecules.", "doi": "10.1126/science.1975955", "issn": "0036-8075", "publisher": "American Association for the Advancement of Science", "publication": "Science", "publication_date": "1990-09-14", "series_number": "4974", "volume": "249", "issue": "4974", "pages": "1303-1306" }, { "id": "authors:j4ybj-20829", "collection": "authors", "collection_id": "j4ybj-20829", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:SNUpnas90", "type": "article", "title": "Rat brain expresses a heterogeneous family of calcium channels", "author": [ { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "Leonard", "given_name": "John P.", "clpid": "Leonard-J-P" }, { "family_name": "Gilbert", "given_name": "Mary M.", "clpid": "Gilbert-M-M" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We describe the isolation and characterization of several rat brain cDNAs that are homologous to the 1 subunit of heart and skeletal muscle dihydropyridine-sensitive Ca channels. Northern blot analysis of 32 cDNAs shows that they can be grouped into four distinct classes (A, B, C, and D), each corresponding to a distinct hybridization pattern of brain mRNAs. Southern blot and DNA sequencing suggest that each class of cDNA represents a distinct gene or gene family. In the regions sequenced, the rat brain class C and D gene products share 75% amino acid identity with the rabbit skeletal muscle Ca channel. In addition, the class C polypeptide is almost identical to the rabbit cardiac Ca channel (97% identity). In contrast, the rat brain class A and B cDNAs are more distantly related to dihydropyridine-sensitive Ca channels (47-64% amino acid identity) and to the brain class C and D genes (51-55% amino acid identity). To examine the functional significance of the isolated brain cDNAs, hybrid depletion experiments were performed in Xenopus oocytes. Antisense oligonucleotides against class A and B cDNAs each partially inhibited, and a class C oligonucleotide almost fully inhibited, the expression of Ba current in rat brain mRNA injected oocytes; but none of the oligonucleotides affected the expression of voltage-gated Na or K conductances. The clone characterization and sequencing results demonstrate that a number of distinct, yet related, voltage-gated Ca-channel genes are expressed in the brain. The antisense oligonucleotide experiments specifically show that one or several of the Ca-channel classes are related to the Ca channels observed in rat brain mRNA injected oocytes.", "doi": "10.1073/pnas.87.9.3391", "pmcid": "PMC53906", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1990-05-01", "series_number": "9", "volume": "87", "issue": "9", "pages": "3391-3395" }, { "id": "authors:56545-4z153", "collection": "authors", "collection_id": "56545-4z153", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:AULpnas90", "type": "article", "title": "A Neutral Amino Acid Change in Segment IIS4 Dramatically Alters the Gating Properties of the Voltage-Dependent Sodium Channel", "author": [ { "family_name": "Auld", "given_name": "V. J.", "clpid": "Auld-V-J" }, { "family_name": "Goldin", "given_name": "A. L.", "clpid": "Goldin-A-L" }, { "family_name": "Krafte", "given_name": "D. S.", "clpid": "Krafte-D-S" }, { "family_name": "Catterall", "given_name": "W. A.", "clpid": "Catterall-W-A" }, { "family_name": "Lester", "given_name": "H. A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "N.", "clpid": "Davidson-N-R" }, { "family_name": "Dunn", "given_name": "R. J.", "clpid": "Dunn-R-J" } ], "abstract": "Sodium channels encoded by the rat IIA cDNA clone [Auld, V. J., Goldin, A. L., Krafte, D. S., Marshall, J., Dunn, J., Catterall, W. A., Lester, H. A., Davidson, N. & Dunn, R. J. (1988) Neuron 1, 449-461] differ at seven amino acid residues from those encoded by the rat II cDNA [Noda, M., Ikeda, T., Kayano, T., Suzuki, H., Takeshima, H., Kurasaki, M., Takahashi, H. & Numa, S. (1986) Nature (London) 320, 188-192]. When expressed in Xenopus oocytes, rat IIA channels display a current-voltage relationship that is shifted 20-25 mV in the depolarizing direction relative to channels expressed from rat II cDNA or rat brain poly(A)+ mRNA. By modifying each variant residue in rat IIA to the corresponding residue in rat II, we demonstrate that a single Phe \u2192 Leu substitution at position 860 in the S4 segment of domain II is sufficient to shift the current-voltage relationship to that observed for channels expressed from rat brain poly(A)+ RNA or rat II cDNA. Rat genomic DNA encodes leucine but not phenylalanine at position 860, indicating that the phenylalanine at this position in rat IIA cDNA likely results from reverse transcriptase error.", "pmcid": "PMC53255", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1990-01-01", "series_number": "1", "volume": "87", "issue": "1", "pages": "323-327" }, { "id": "authors:ty7c7-wam06", "collection": "authors", "collection_id": "ty7c7-wam06", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20170408-161145019", "type": "article", "title": "An open-channel blocker interacts with adjacent turns of \u03b1-helices in the nicotinic acetylcholine receptor", "author": [ { "family_name": "Charnet", "given_name": "Pierre", "clpid": "Charnet-P" }, { "family_name": "Labarca", "given_name": "Cesar", "clpid": "Labarca-C" }, { "family_name": "Leonard", "given_name": "Reid J.", "clpid": "Leonard-R-J" }, { "family_name": "Vogelaar", "given_name": "Nancy J.", "clpid": "Vogelaar-N-J" }, { "family_name": "Czyzyk", "given_name": "Linda", "clpid": "Czyzyk-L" }, { "family_name": "Gouin", "given_name": "Annie", "clpid": "Gouin-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The binding site for an open-channel blocker, QX-222, at mouse muscle nicotinic acetylcholine receptors was probed using site-directed mutagenesis, oocyte expression, and elect rophysiologicaI analysis. The proposed cytoplasmic end of the M2 transmembrane helix is termed position 1\u2032. At position 10\u2032 (\u03b1S252, \u03b2T263, \u03b3A261, \u03b4A266), Ala residues yield stronger and longer binding of QX-222 than Ser or Thr residues. These effects are opposite and roughly equal (30%\u201350% per mutation) to previously reported effects at position 6\u2032. The polar end of an anesthetic molecule seems to bind to the position 6\u2032 OH groups, which provide a water-like region; the nonpolar moiety is near position 10\u2032 and binds more strongly in a nonpolar environment. Interactions with adjacent OH-rich turns of an amphiphilic helix may explain the widespread blocking effects of local anesthetics at the conduction pore of ion channels.", "doi": "10.1016/0896-6273(90)90445-L", "issn": "0896-6273", "publisher": "Neuron", "publication": "Neuron", "publication_date": "1990-01", "series_number": "1", "volume": "4", "issue": "1", "pages": "87-95" }, { "id": "authors:6xmv6-sdg88", "collection": "authors", "collection_id": "6xmv6-sdg88", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:YULjbc89", "type": "article", "title": "Functional expression of the yeast alpha-factor receptor in Xenopus oocytes", "author": [ { "family_name": "Yu", "given_name": "Lei", "clpid": "Yu-Lei" }, { "family_name": "Blumer", "given_name": "Kendall J.", "clpid": "Blumer-K-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Thorner", "given_name": "Jeremy", "clpid": "Thorner-J" } ], "abstract": "The STE2 gene of the yeast Saccharomyces cerevisiae encodes a 431- residue polypeptide that has been shown by chemical cross-linking and genetic studies to be a component of the receptor for the peptide mating pheromone, alpha-factor. To demonstrate directly that the ligand binding site of the alpha-factor receptor is comprised solely of the STE2 gene product, the STE2 protein was expressed in Xenopus oocytes. Oocytes microinjected with synthetic STE2 mRNA displayed specific surface binding for 35S-labeled alpha-factor (up to 40 sites/micron2/ng RNA). Oocytes injected with either STE2 antisense RNA or heterologous receptor mRNA (nicotinic acetylcholine receptor alpha, beta, gamma, and delta subunit mRNAs) showed no binding activity (indistinguishable from uninjected control oocytes). The apparent KD (7 nM) of the alpha-factor binding sites expressed on the oocyte surface, determined by competition binding studies, agreed with the values reported for intact yeast cells and yeast plasma membrane fractions. These findings demonstrate that the STE2 gene product is the only yeast polypeptide required for biogenesis of a functional alpha-factor receptor. Electrophysiological measurements indicated that the membrane conductance of oocytes injected with STE2 mRNA, or with both STE2 and GPA1 (encoding a yeast G protein alpha-subunit) mRNAs, did not change and was not affected by pheromone binding. Thus, the alpha-factor receptor, like mammalian G protein-coupled receptors, apparently lacks activity as an intrinsic or ligand-gated ion channel. This report is the first instance in which a membrane-bound receptor from a unicellular eukaryote has been expressed in a vertebrate cell.", "issn": "0021-9258", "publisher": "American Society for Biochemistry and Molecular Biology", "publication": "Journal of Biological Chemistry", "publication_date": "1989-12-15", "series_number": "35", "volume": "264", "issue": "35", "pages": "20847-20850" }, { "id": "authors:e7ab1-ypy93", "collection": "authors", "collection_id": "e7ab1-ypy93", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:LEOpnas89", "type": "article", "title": "Expression of Drosophila Shaker potassium channels in mammalian cells infected with recombinant vaccinia virus", "author": [ { "family_name": "Leonard", "given_name": "R. J.", "clpid": "Leonard-R-J" }, { "family_name": "Karschin", "given_name": "A.", "clpid": "Karschin-A" }, { "family_name": "Jayashree-Aiyar", "given_name": "S.", "clpid": "Jayashree-Aiyar-S" }, { "family_name": "Davidson", "given_name": "N.", "clpid": "Davidson-N-R" }, { "family_name": "Tanouye", "given_name": "M. A.", "clpid": "Tanouye-M-A" }, { "family_name": "Thomas", "given_name": "L.", "clpid": "Thomas-L" }, { "family_name": "Thomas", "given_name": "G.", "clpid": "Thomas-G" }, { "family_name": "Lester", "given_name": "H. A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "A recombinant vaccinia virus containing a Drosophila potassium channel (Shaker H4) cDNA was constructed by homologous recombination between wild-type vaccinia virus DNA and a transfer plasmid. The new virus was used to infect four types of mammalian cells in culture. Electrophysiological recording 24-72 hr after infection revealed the expression of voltage-gated transient potassium channels in all four cell types. The properties of the induced currents were identical to those previously observed following injection of the Shaker H4 transcript into oocytes. Vaccinia promises to be an effective vehicle for the heterologous expression of transmembrane ion channels in a variety of cell types.", "pmcid": "PMC298120", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1989-10-01", "series_number": "19", "volume": "86", "issue": "19", "pages": "7629-7633" }, { "id": "authors:rtq0q-a3h65", "collection": "authors", "collection_id": "rtq0q-a3h65", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201012-160322461", "type": "article", "title": "Expression of mRNA Encoding Voltage-Dependent Ca Channels in Xenopus Oocytes: Review and Progress Report", "author": [ { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "Leonard", "given_name": "John P.", "clpid": "Leonard-J-P" }, { "family_name": "Nargeot", "given_name": "Joel", "clpid": "Nargeot-J" }, { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Curtis", "given_name": "Benson M.", "clpid": "Curtis-B-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We are studying electrically excitable Ca channels with an approach that combines nucleic acid molecular biology and membrane biophysics. Gurdon et al. first employed Xenopus oocytes as a system for heterologous expression of RNA. This system was later adapted for electrophysiological studies of ion channels by Barnard, Miledi, and their colleagues. Although other expression systems are being developed for membrane channels [Claudio et al. and Beam et al., this volume], the oocyte is now the most common, robust, and best-characterized system. Experiments in which channels are expressed by RNA injections in oocytes have at least three major goals.", "doi": "10.1111/j.1749-6632.1989.tb24094.x", "issn": "0077-8923", "publisher": "New York Academy of Sciences", "publication": "Annals of the New York Academy of Sciences", "publication_date": "1989-06", "volume": "560", "pages": "174-182" }, { "id": "authors:dpyaz-xy981", "collection": "authors", "collection_id": "dpyaz-xy981", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201012-122452479", "type": "article", "title": "Further evidence demonstrating that N-methyl-D-aspartate and kainate activate distinct ion channels", "author": [ { "family_name": "Fong", "given_name": "Tung Ming", "clpid": "Fong-Tung-Ming" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Several excitatory amino acid receptors encoded by rat brain mRNA were expressed in Xenopus oocytes. Experimental protocols using an open channel blocker (MK\u2010801) were designed to test the common receptor\u2010channel hypothesis in which N\u2010methyl\u2010D\u2010aspartate (NMDA) and kainate activate the same ion channel but induce different open channel conformations with different ionic permeabilities. The present data demonstrate that NMDA exposes previously trapped MK\u2010801 molecules to the transmembrane field and accelerates their dissociation from the channel at positive potentials, while kainate lacks this effect, Therefore, kainate does not activate the same ion channel as NMDA does. Furthermore, differential inhibition of the NMDA response or the kainate response by the competitive antagonists D\u20102\u2010amino\u20105\u2010phosphonopentanoic acid (D\u2010AP5) and 6\u2010cyano\u20107\u2010nitroquinoxaline\u20102,3\u2010dione (CNQX) indicates that NMDA and kainate do not share the same binding site. Thus, these several lines of evidence demonstrate that two distinct receptor\u2010channels are activated by NMDA and kainate, respectively.", "doi": "10.1002/syn.890040110", "issn": "0887-4476", "publisher": "Wiley", "publication": "Synapse", "publication_date": "1989", "series_number": "1", "volume": "4", "issue": "1", "pages": "88-95" }, { "id": "authors:bf4rv-ss269", "collection": "authors", "collection_id": "bf4rv-ss269", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20150128-145454703", "type": "article", "title": "Evidence that the M2 membrane-spanning region lines the ion channel pore of the nicotinic receptor", "author": [ { "family_name": "Leonard", "given_name": "Reid J.", "clpid": "Leonard-R-J" }, { "family_name": "Labarca", "given_name": "Cesar G.", "clpid": "Labarca-C-G" }, { "family_name": "Charnet", "given_name": "Pierre", "clpid": "Charnet-P" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Site-directed mutagenesis and expression in Xenopus oocytes were used to study acetylcholine receptors in which serine residues (i) were replaced by alanines (alpha, delta subunits) or (ii) replaced a phenylalanine (beta subunit) at a postulated polar site within the M2 transmembrane helix. As the number of serines decreased, there were decreases in the residence time and consequently the equilibrium binding affinity of QX-222, a quaternary ammonium anesthetic derivative thought to bind within the open channel. Receptors with three serine-to-alanine mutations also displayed a selective decrease in outward single-channel currents. Both the direction of this rectification and the voltage dependence of QX-222 blockade suggest that the residues mutated are within the aqueous pore of the receptor and near its cytoplasmic (inner) surface.", "doi": "10.1126/science.2462281", "issn": "0036-8075", "publisher": "American Association for the Advancement of Science", "publication": "Science", "publication_date": "1988-12-16", "series_number": "4885", "volume": "242", "issue": "4885", "pages": "1578-1581" }, { "id": "authors:ry3vr-ybn44", "collection": "authors", "collection_id": "ry3vr-ybn44", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201013-140643992", "type": "article", "title": "At least two mRNA species contribute to the properties of rat brain A-type potassium channel expressed in xenopus oocytes", "author": [ { "family_name": "Rudy", "given_name": "Bernardo", "clpid": "Rudy-Bernardo" }, { "family_name": "Hoger", "given_name": "Jeff H.", "clpid": "Hoger-J-H" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Fast transient K\u207a channels (A channels) of the type operating in the subthreshold region for Na\u207a action potential generation were expressed in Kenopus oocytes injected with rat brain poly(A) RNA. Sucrose gradient fractionation of the RNA separates mRNAs encoding A-currents (6\u20137 kb) from mRNAs encoding other voltage-dependent K\u207a channels. A-currents expressed with fractionated mRNA differ in kineticsAnd pharmacology from A-currents expressed with total mRNA. The original properties of the A-currents can be reconstituted when small mRNAs (2\u20134 kb) are added to the large mRNA fraction. Thus the properties of the A-currents expressed with total poly(A) RNA depend on the presence of more than one mRNA species. mRNA(s) present in the large RNA fraction must encode channel subunits since they express an A-current by themselves. The small mRNA(s) may encode a second subunit(s) or a factor, such as an enzymatic activity that modulates the properties of the channels, which could play a role in generating A-channel functional diversity.", "doi": "10.1016/0896-6273(88)90164-x", "issn": "0896-6273", "publisher": "Cell Press", "publication": "Neuron", "publication_date": "1988-10", "series_number": "8", "volume": "1", "issue": "8", "pages": "649-658" }, { "id": "authors:4xykn-3ce46", "collection": "authors", "collection_id": "4xykn-3ce46", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20191104-094627196", "type": "article", "title": "Evidence for the involvement of more than one mRNA species in controlling the inactivation process of rat and rabbit brain Na channels expressed in Xenopus oocytes", "author": [ { "family_name": "Krafte", "given_name": "Douglas S.", "clpid": "Krafte-D-S" }, { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "Leonard", "given_name": "John P.", "clpid": "Leonard-J-P" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The properties of rat and rabbit brain sodium (Na) channels expressed in Xenopus oocytes following either unfractionated or high-molecular- weight mRNA injections were compared to assess the relative contribution of different size messages to channel function. RNA was size-fractionated on a sucrose gradient and a high-molecular-weight fraction (7\u201310 kilobase) encoding the \u03b1-subunit gave rise to functional voltage-dependent Na channels in the oocyte membrane. Single- channel conductance, mean open time, and time to first opening were all similar to the values for channels following injection of unfractionated RNA. In contrast, inactivation properties were markedly different; Na currents from high-molecular-weight RNA inactivated with a several-fold smaller macroscopic inactivation rate and showed a steady-state voltage dependence that was shifted in the depolarizing direction by at least 10 mV relative to that for unfractionated RNA. Single-channel recording revealed that the kinetic difference arose from a greater probability for high-molecular-weight RNA induced channels to reopen during a depolarizing voltage step. Pooling all gradient fractions and injecting this RNA into oocytes led to the appearance of Na channels with inactivation properties indistinguishable from those following injection of unfractionated RNA. These results suggest that mRNA species not present in the high- molecular-weight fraction can influence the inactivation process of rat brain Na channels expressed in Xenopus oocytes. This mRNA may encode \u03b2-subunits or other proteins that are involved in posttranslational processing of voltage-dependent Na channels.", "doi": "10.1523/jneurosci.08-08-02859.1988", "pmcid": "PMC6569391", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "1988-08-01", "series_number": "8", "volume": "8", "issue": "8", "pages": "2859-2868" }, { "id": "authors:kd917-8zq70", "collection": "authors", "collection_id": "kd917-8zq70", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:IVEpnas88b", "type": "article", "title": "A-Type Potassium Channels Expressed from Shaker Locus cDNA", "author": [ { "family_name": "Iverson", "given_name": "L. E.", "clpid": "Iverson-L-E" }, { "family_name": "Tanouye", "given_name": "M. A.", "clpid": "Tanouye-M-A" }, { "family_name": "Lester", "given_name": "H. A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "N.", "clpid": "Davidson-N-R" }, { "family_name": "Rudy", "given_name": "B.", "clpid": "Rudy-B" } ], "abstract": "A-type K+ currents are expressed in Xenopus oocytes injected with in vitro-synthesized transcripts from cDNAs for the Drosophila Shaker (Sh) locus. A single Sh gene product, possibly as a multimer, is sufficient for formation of functional A channels. Various Sh RNAs express A currents with distinct kinetic properties. An analysis of structure-function relationships shows that the conserved central region of Sh polypeptides determines ionic selectivity and overall channel behavior, whereas the divergent amino and carboxyl termini can modify channel kinetics. Alternative splicing of Sh gene transcripts may provide one mechanism for the generation of K+ channel diversity.", "pmcid": "PMC281833", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1988-08-01", "series_number": "15", "volume": "85", "issue": "15", "pages": "5723-5727" }, { "id": "authors:46n7k-44n52", "collection": "authors", "collection_id": "46n7k-44n52", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201013-140644253", "type": "article", "title": "A rat brain Na\u207a channel \u03b1 subunit with novel gating properties", "author": [ { "family_name": "Auld", "given_name": "Vanessa J.", "clpid": "Auld-V-J" }, { "family_name": "Goldin", "given_name": "Alan L.", "clpid": "Goldin-A-L" }, { "family_name": "Krafte", "given_name": "Douglas S.", "clpid": "Krafte-D-S" }, { "family_name": "Marshall", "given_name": "John", "clpid": "Marshall-John" }, { "family_name": "Dunn", "given_name": "James M.", "clpid": "Dunn-J-M" }, { "family_name": "Catterall", "given_name": "William A.", "clpid": "Catterall-W-A" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Dunn", "given_name": "Robert J.", "clpid": "Dunn-R-J" } ], "abstract": "We have constructed a full-length rat brain Na+ channel \u03b1 subunit cDNA that differs from the previously reported a subunit of Noda et al. at 6 amino acid positions. Transcription of the cDNA in vitro and injection into Xenopus oocytes resulted in the synthesis of functional Na\u207a channels. Although the single-channel conductance of the channels resulting from cloned cDNA was the same as that of channels resulting from injection of rat brain RNA, we observed two significant differences in the gating properties of the channels. The Na+ currents from cloned cDNA displayed much slower macroscopic inactivation compared with those from rat brain mRNA. In addition, the current-voltage relationship for currents from cloned cDNA was shifted 20\u201325 mV in the depolarizing direction compared with currents from rat brain RNA. Coinjection of low MW rat brain RNA restored normal inactivation of the channels indicating the presence of a component, either a structural subunit of the channel complex or a modifying enzyme, necessary for normal gating of the channel.", "doi": "10.1016/0896-6273(88)90176-6", "issn": "0896-6273", "publisher": "Cell Press", "publication": "Neuron", "publication_date": "1988-08", "series_number": "6", "volume": "1", "issue": "6", "pages": "449-461" }, { "id": "authors:mmdtz-q9031", "collection": "authors", "collection_id": "mmdtz-q9031", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201013-140644398", "type": "article", "title": "Tetrodotoxin-sensitive voltage-dependent Na currents recorded from Xenopus oocytes injected with mammalian cardiac muscle RNA", "author": [ { "family_name": "Sutton", "given_name": "Fedora", "clpid": "Sutton-Fedora" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Voltage-sensitive sodium (Na) channel currents recorded from mammalian cardiac muscle are blocked by tetrodotoxin (TTX) with a K_d of 1\u20133 \u03bcM. We have observed a K_d for TTX of 4\u201310 nM for Na currents recorded from Xenopus oocytes injected with RNA extracted from rabbit cardiac muscle. This result suggests that the degree of TTX sensitivity of Na channels encoded by cardiac muscle mRNA is in part determined by post-translational modification(s) or of associations with accessory proteins in the membrane.", "doi": "10.1016/0169-328x(88)90065-4", "issn": "0169-328X", "publisher": "Elsevier", "publication": "Molecular Brain Research", "publication_date": "1988-04", "series_number": "2", "volume": "3", "issue": "2", "pages": "187-191" }, { "id": "authors:5vyby-2he07", "collection": "authors", "collection_id": "5vyby-2he07", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201020-070235564", "type": "article", "title": "Properties of two classes of rat brain acidic amino acid receptors induced by distinct mRNA populations in Xenopus oocytes", "author": [ { "family_name": "Fong", "given_name": "Tung Ming", "clpid": "Fong-Tung-Ming" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The Xenopus laevis oocyte expression system was used to study the molecular composition of mRNAs encoding acidic amino acid (AA) receptors from rat brain. Xenopus oocytes injected with poly(A) mRNA express two general classes of AA receptors. One class consists of AA\u2010gated cation channels. Responses are evoked by N\u2010methyl\u2010D\u2010aspartate (NMDA), by kainate, and to a lesser extent by L\u2010glutamate or quisqualate. The second class of receptor is coupled to an intracellular second messenger pathway activating an oocyte\u2010encoded Ca\u00b2\u207a\u2010activated Cl\u207b conductance. This second messenger\u2010coupled AA receptor can be activated by L\u2010glutamate or quisqualate. DL\u20102\u2010amino\u20105\u2010phosphonopentanoic acid and D\u2010\u03b1\u2010aminohexanedioic acid inhibit the AA\u2010gated cation conductances activated by NMDA or kainate with different potencies but do not inhibit the second messenger\u2010coupled AA receptor. Responses to NMDA are enhanced by micromolar level of glycine and are inhibited by Mg\u00b2\u207a, Zn\u00b2\u207a, or MK\u2010801. Dose\u2010response analysis reveals that the AA\u2010gated cation conductance activated by kainate requires the binding of two agonist molecules. To study the molecular composition, the mRNAs were size fractionated by denaturing agarose gel electrophoresis. About 20\u2010fold purification in specific activity (nA/ng of mRNA injected) of mRNAs encoding the second messenger coupled AA receptor was achieved. In contrast, only a slight enrichment of the mRNAs encoding the AA\u2010gated channel was observed. This suggests that the second messenger coupled AA receptor is encoded by a single size class of mRNA, whereas the AA\u2010gated cation channel(s) is encoded by multiple species of mRNAs or by mRNAs whose size distribution is heterogeneous.", "doi": "10.1002/syn.890020613", "issn": "0887-4476", "publisher": "Wiley", "publication": "Synapse", "publication_date": "1988", "series_number": "6", "volume": "2", "issue": "6", "pages": "657-665" }, { "id": "authors:tnyrm-b0736", "collection": "authors", "collection_id": "tnyrm-b0736", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:GORpnas87", "type": "article", "title": "Tissue-specific expression of the RI and RII sodium channel subtypes", "author": [ { "family_name": "Gordon", "given_name": "Dalia", "clpid": "Gordon-D" }, { "family_name": "Merrick", "given_name": "Dawn", "clpid": "Merrick-D" }, { "family_name": "Auld", "given_name": "Vanessa", "clpid": "Auld-V-J" }, { "family_name": "Dunn", "given_name": "Robert", "clpid": "Dunn-R-J" }, { "family_name": "Goldin", "given_name": "Alan L.", "clpid": "Goldin-A-L" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Catterall", "given_name": "William A.", "clpid": "Catterall-W-A" } ], "abstract": "Anti-peptide antibodies that distinguish between the rat brain sodium channel subtypes referred to as RI and RII were prepared and used to determine their relative expression in nerve and muscle tissues. Sodium channels purified from rat brain are approximately 18% RI and 80% RII. In brain, the RII subtype is preferentially expressed with RI/RII ratios ranging from 0.07 in the hippocampus to 0.17 in the cerebral cortex. The RI subtype is preferentially expressed in more caudal areas of the central nervous system with values of RI/RII of 0.98 for medulla oblongata and 2.2 for spinal cord. Expression of additional unidentified sodium channel subtype(s) is detected in midbrain, medulla, and spinal cord, and expression of unidentified sodium channel subtypes predominates over expression of RI and RII in retina and optic nerve. The RI and RII subtypes are primarily expressed in the central nervous system and are not detected in significant numbers in skeletal or cardiac muscle, sympathetic ganglia, adrenal medulla, sciatic nerve, or cauda equina. The RII subtype appears first in development of both brain and spinal cord but declines in adult spinal cord as the RI subtype increases. The strict regional expression of these two sodium channel subtypes suggests that they may have distinct functional properties or physiological roles.", "doi": "10.1073/pnas.84.23.8682", "pmcid": "PMC299610", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1987-12-01", "series_number": "23", "volume": "84", "issue": "23", "pages": "8682-8686" }, { "id": "authors:ncchb-n8e19", "collection": "authors", "collection_id": "ncchb-n8e19", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:GARmcb87", "type": "article", "title": "Developmentally regulated expression of a truncated myosin light-chain 1F/3F gene", "author": [ { "family_name": "Garfinkel", "given_name": "Leonard I.", "clpid": "Garfinkel-L-I" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Fast skeletal muscle myosin light-chain I (MLC1f) and myosin light-chain 3 (MLC3f) mRNAs are both derived from a single rat MLC1/3f gene. MLC1f mRNA begins at the first exon of the gene, while MLC3f mRNA begins with exon 2, 10 kilobases downstream. Both mRNAs require alternate splicing of internal exons for accurate expression. We showed that a truncated rat MLC1f/3f gene lacking exon 1 and the first 6.3 kilobases of the intron separating exons 1 and 2 produced rat MLC3f mRNA in a developmentally regulated manner after introduction into myogenic mouse cells, thus demonstrating in vivo the presence of a functional promoter associated with exon 2. Correctly spliced mRNA was produced after transfer of this truncated gene into both myogenic and nonmyogenic cells, indicating that the pattern of splicing of this complex transcript was due to a structural features of the RNA and was independent of cell type.", "issn": "0270-7306", "publisher": "Molecular and Cellular Biology", "publication": "Molecular and Cellular Biology", "publication_date": "1987-10-01", "series_number": "10", "volume": "7", "issue": "10", "pages": "3826-3829" }, { "id": "authors:t1fdc-mzb59", "collection": "authors", "collection_id": "t1fdc-mzb59", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120622-143923786", "type": "article", "title": "Equilibrium Properties of Mouse-Torpedo Acetylcholine Receptor Hybrids Expressed in Xenopus Oocytes", "author": [ { "family_name": "Yoshii", "given_name": "Kiyonori", "clpid": "Yoshii-Kiyonori" }, { "family_name": "Yu", "given_name": "Lei", "clpid": "Yu-Lei" }, { "family_name": "Mayne", "given_name": "Katharine Mixter", "clpid": "Mayne-K-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "This study used messenger RNA encoding each subunit (\u03b1, \u03b2, \u03b3\nand \u03b4) of the nicotinic acetylcholine (ACh) receptor from mouse BC3H-1 cells and from Torpedo electric organ. The mRNA was synthesized in vitro by transcription with SP6 polymerase from cDNA clones. All 16 possible combinations that include one mRNA for each of \u03b1, \u03b2, \u03b3 and \u03b4 were injected into oocytes. After allowing 2-8 d for translation and assembly, we assayed each oocyte for (a) receptor assembly, measured by the binding of [^125]\u03b1-bungarotoxin to the oocyte surface, and (b) ACh-induced conductance, measured under voltage clamp at various membrane potentials. All combinations yielded detectable\nassembly (30-fold range among different combinations) and ACh-induced\nconductances (>1,000-fold range at 1 \u00b5M). On double-logarithmic coordinates, the dose-response relations all had a slope near 2 for low concentrations of ACh. Data were corrected for variations in efficiency of translation among identically injected oocytes by expressing ACh-induced conductance per femtomole\nof \u03b1-bungarotoxin-binding sites. Five combinations were tested for d-tubocurarine\ninhibition by the dose-ratio method; the apparent dissociation\nconstant ranged from 0.08 to 0.27 \u00b5M. Matched responses and geometric\nmeans are used for describing the effects of changing a particular subunit\n(mouse vs. Torpedo) while maintaining the identity of the other subunits. A\ndramatic subunit-specific effect is that of the \u03b2 subunit on voltage sensitivity of\nthe response: g_ACh(-90 mV)/g_Ach(+30 mV) is always at least 1, but this ratio\nincreases by an average of 3.5-fold if \u03b2_M replaces \u03b2_T. Also, combinations\nincluding \u03b3_T or \u03b4_M usually produce greater receptor assembly than combinations\nincluding the homologous subunit from the other species. Finally, E_ACh is\ndefined as the concentration of ACh inducing 1 \u00b5S/fmol at -60 mV; E_ACh is\nconsistently lower for \u03b1_m. We conclude that receptor assembly, voltage sensitivity,\nand E_ACh are governed by different properties.", "doi": "10.1085/jgp.90.4.553", "pmcid": "PMC2228871", "issn": "0022-1295", "publisher": "Rockefeller University Press", "publication": "Journal of General Physiology", "publication_date": "1987-10-01", "series_number": "4", "volume": "90", "issue": "4", "pages": "553-573" }, { "id": "authors:dcjmm-nz288", "collection": "authors", "collection_id": "dcjmm-nz288", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201013-140644515", "type": "article", "title": "Expression of mouse-Torpedo acetylcholine receptor subunit chimeras and hybrids in Xenopus oocytes", "author": [ { "family_name": "Mayne", "given_name": "Katharine Mixter", "clpid": "Mayne-K-M" }, { "family_name": "Yoshii", "given_name": "Kiyonori", "clpid": "Yoshii-Kiyonori" }, { "family_name": "Yu", "given_name": "Lei", "clpid": "Yu-Lei" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "In this study, in vitro synthesized mRNA encoding mouse and Torpedo nicotinic acetylcholine receptor subunits was injected into Xenopus oocytes, followed by assays for assembly onto the oocyte surface (using [\u00b9\u00b2\u2075I]\u03b1-bungarotoxin binding) and for acetylcholine-induced conductances (using voltage clamp). We constructed hybrid acetylcholine receptors in Xenopus oocytes by injecting all 8 possible combinations of 4 subunit-specific mRNAs in which a single subunit is derived from the other species. For each hybrid combination, there is detectable assembly and conductance. We also constructed cDNA clones that encode chimeric acetylcholine receptor subunits in which part of the \u03b3 subunit from Torpedo was replaced by the homologous region of the \u03b4 subunit from mouse. None of the chimeric subunits was able to replace the Torpedo \u03b3, mouse \u03b4, or Torpedo \u03b4 subunit with regard to assembly or function. We therefore conclude that widely spaced (and unknown) parts of the protein chain are required for the intersubunit interactions that eventually lead to functional assembly of the receptor.", "doi": "10.1016/0169-328x(87)90026-x", "issn": "0169-328X", "publisher": "Elsevier", "publication": "Molecular Brain Research", "publication_date": "1987-09", "series_number": "3", "volume": "2", "issue": "3", "pages": "191-197" }, { "id": "authors:gf8ej-98x21", "collection": "authors", "collection_id": "gf8ej-98x21", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:LUBpnas87", "type": "article", "title": "cDNA Cloning of a Serotonin 5-HT1C Receptor by Electrophysiological Assays of mRNA-Injected Xenopus Oocytes", "author": [ { "family_name": "L\u00fcbbert", "given_name": "Hermann", "clpid": "L\u00fcbbert-H" }, { "family_name": "Hoffman", "given_name": "Beth J.", "clpid": "Hoffman-B-J" }, { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "van Dyke", "given_name": "Terry", "clpid": "van-Dyke-T" }, { "family_name": "Levine", "given_name": "Arnold J.", "clpid": "Levine-A-J" }, { "family_name": "Hartig", "given_name": "Paul R.", "clpid": "Hartig-P-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We describe a strategy for the cloning of neurotransmitter-receptor and ion-channel cDNAs that is based on electrophysiological assays of mRNA-injected Xenopus oocytes. This procedure circumvents the purification of these membrane proteins, which is hindered by their low abundance and their hydrophobic nature. It involves methods for RNA fractionation by high-resolution gel electrophoresis, directional cDNA cloning in a single-stranded vector, and screening of the cDNA library by voltage-clamp measurements of currents induced by serotonin in mRNA-injected oocytes. The applicability of our approach is demonstrated by the isolation of a serotonin receptor cDNA clone from a mouse choroid plexus papilloma. The clone was identified by hybrid-depletion and hybrid-selection procedures. The receptor expressed in oocytes injected with hybrid-selected RNA is fully functional, indicating that it is composed of a single subunit encoded by a 5-kilobase RNA. The pharmacology of the hybrid-selected receptor confirms that we have successfully cloned a serotonin 5-HT1C receptor cDNA.", "pmcid": "PMC305079", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1987-06-15", "series_number": "12", "volume": "84", "issue": "12", "pages": "4332-4336" }, { "id": "authors:6ak2s-7ed60", "collection": "authors", "collection_id": "6ak2s-7ed60", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201013-145241211", "type": "article", "title": "Rat brain 5-HT_(1C) receptors are encoded by a 5-6 kbase mRNA size class and are functionally expressed in injected Xenopus oocytes", "author": [ { "family_name": "L\u00fcbbert", "given_name": "Hermann", "clpid": "L\u00fcbbert-H" }, { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Injection of rat brain RNA into Xenopus laevis oocytes induces synthesis of receptors that show an electrophysiological response to bath application of serotonin. While there are at least 4 pharmacologically distinct subtypes of 5-HT binding sites in the rat brain, we find that the pharmacological characteristics of the predominant electrophysiologically active receptor synthesized in Xenopus oocytes are most consistent with those of the 5-HT_(1C) subtype. Additional electrophysiologically active 5-HT receptor types could not be detected. Injection of mRNA isolated from a number of rat brain regions shows that the choroid plexus is particularly enriched for 5-HT_(1C) mRNA. Oocytes injected with RNA isolated from this region respond 16 or 8 times more strongly to serotonin than do oocytes injected with RNA isolated from cortex or substantia nigra, respectively. In addition, by fractionation of rat brain mRNA through agarose gels, we have identified a single RNA size class of about 5\u20136 kbase that encodes this serotonin receptor.", "doi": "10.1523/jneurosci.07-04-01159.1987", "pmcid": "PMC6569006", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "1987-04", "series_number": "4", "volume": "7", "issue": "4", "pages": "1159-1165" }, { "id": "authors:jsw59-djg40", "collection": "authors", "collection_id": "jsw59-djg40", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201013-145241336", "type": "article", "title": "Ca channels induced in Xenopus oocytes by rat brain mRNA", "author": [ { "family_name": "Leonard", "given_name": "John P.", "clpid": "Leonard-J-P" }, { "family_name": "Nargeot", "given_name": "Jo\u00ebl", "clpid": "Nargeot-J" }, { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "RNA was isolated from brains of 16-d-old rats and poly(A) samples were injected into stage V and VI oocytes. After allowing 2\u20135 d for expression, most oocytes were exposed to medium in which the K had been replaced by Cs for 24 hr prior to recording. Ba currents were usually measured in Cl-free Ba-methanesulfonate saline. \n\nI_(Ba) in noninjected oocytes was often undetectable, but ranged up to 50 nA (22 \u00b1 4 nA, n = 21). In contrast, injected oocytes showed a peak I_(Ba) of 339 \u00b1 42 nA (n = 33). The threshold for activation of I_(Ba) was -40 mV, with peak currents at +10 to +20 mV. After a peak, currents decayed to a nearly steady level along a single-exponential time course (\u03c4 = 650 \u00b1 50 msec at +20 mV). The maintained current was 67 \u00b1 6% (n = 9) of the early peak amplitude. A prepulse duration of 5 sec was needed to examine the inactivation of barium currents in injected oocytes. The inward I_(Ba) could be observed in BaCl\u2082 solutions at potentials positive to E_(Cl) and also in Na-free salines, indicating that neither Cl\u207b nor Na\u207a was carrying the inward current. \n\nAlthough I_(Ba) displayed voltage- independent blockade by Cd (50% inhibition at 6 \u00b5M), the peptide Ca channel antagonist, \u03c9-CgTX (1 \u00b5M), and the organic Ca channel-blocking agents (verapamil, compound W-7, and nifedipine) were uniformly ineffective. No effects were observed with the dihydropyridine antagonist nifedipine (even at 10 \u00b5M, or when cells were held at -40 mV) or agonist Bay K-8644. However, I_(Ba) was enhanced via activation of protein kinase C with 4-beta-phorbol dibutyrate (PBT\u2082). In contrast, use of forskolin to activate protein kinase A did not alter I_(Ba). However, experiments in the presence of Cd revealed that forskolin decreased I_K. Ca channels produced by rat brain mRNA were thus in contrast to the nifedipine-sensitive, Bay K-8644- and forskolin-enhanced Ca channels observed after injection of rat heart mRNA (Dascal et al., 1986).", "doi": "10.1523/jneurosci.07-03-00875.1987", "pmcid": "PMC6569056", "issn": "0270-6474", "publisher": "Society for Neuroscience", "publication": "Journal of Neuroscience", "publication_date": "1987-03", "series_number": "3", "volume": "7", "issue": "3", "pages": "875-881" }, { "id": "authors:63efz-h8f54", "collection": "authors", "collection_id": "63efz-h8f54", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201009-153923021", "type": "article", "title": "Characterization of voltage-gated calcium channels in Xenopus oocytes after injection of RNA from electrically excitable tissues", "author": [ { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "Leonard", "given_name": "John P.", "clpid": "Leonard-J-P" }, { "family_name": "Nargeot", "given_name": "Jo\u00ebl", "clpid": "Nargeot-J" }, { "family_name": "L\u00fcbbert", "given_name": "Hermann", "clpid": "L\u00fcbbert-H" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "The entry of Ca\u00b2\u207a through voltage-gated channels has two major functions. First, Ca\u00b2\u207a fluxes elevate the intracellular concentration of this important second messenger. Second, Ca\u00b2\u207a currents directly influence membrane potential, thereby contributing to impulse patterns. Ca\u00b2\u207a channels serve these functions in a variety of nerve, muscle, and endocrine cells (Reuter, 1983; Tsien, 1983). As might be expected from their wide distribution and their role in regulating a number of cellular functions, voltage-gated Ca\u00b2\u207a channels form a heterogeneous family. Diverse types of Ca\u00b2\u207a channels can be distinguished with regard to gating kinetics, pharmacology, and permeability (Fox and Krasne, 1981; Armstrong and Matteson, 1985; Nowyeky et al., 1985). For the purpose of characterizing the various forms of voltage-gated Ca\u00b2\u207a channels, it would be desirable to study them in a similar membrane environment.", "issn": "0094-7733", "publisher": "Raven Press", "publication": "Society of General Physiologists series", "publication_date": "1987", "volume": "42", "pages": "153-166" }, { "id": "authors:ek9g9-dhg92", "collection": "authors", "collection_id": "ek9g9-dhg92", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201012-152225953", "type": "article", "title": "Involvement of a GTP-binding protein in mediation of serotonin and acetylcholine responses in Xenopus oocytes injected with rat brain messenger RNA", "author": [ { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Ifune", "given_name": "Catherine", "clpid": "Ifune-Catherine" }, { "family_name": "Hopkins", "given_name": "Rosemary", "clpid": "Hopkins-R-S" }, { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "L\u00fcbbert", "given_name": "Hermann", "clpid": "L\u00fcbbert-H" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Simon", "given_name": "Melvin I.", "clpid": "Simon-M-I" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Injection of poly(A)\u207a RNA from rat brain into Xenopus oocytes caused the appearance of Cl currents in response to serotonin (5-HT) and acetylcholine (ACh). Both neurotransmitters evoked two-component currents similar in their time course to the oocyte's endogenous cholinergic muscarinic response, which was shown in previous studies to be mediated by IP\u2083 synthesis leading to Ca release from intracellular stores. The responses to ACh and 5-HT exhibited self- and cross-desensitization, i.e., application of either ACh or 5-HT inhibited the subsequent response to either one of the two transmitters. Intracellular injection of guanosine 5\u2032-O-(3-thiotriphosphate) (GTP-\u03b3-S) mimicked the 5-HT and ACh response, and also completely suppressed the response to the subsequent application of either ACh or 5-HT. Treatment of the oocytes with pertussis toxin (PTX) caused a 50% attenuation of ACh and 5-HT responses. In the membranes of both control and mRNA-injected oocytes, PTX catalyzed the ADP-ribosylation of a single M_r = \u223c40,000 protein. Injection of the purified \u03b2\u03b3-subunits of transducin enhanced the 5-HT response. The 5-HT and GTP-\u03b3-S responses were inhibited by intracellular injection of the Ca\u00b2\u207a chelator, EGTA, as previously shown for the ACh response. These data suggest that ACh and 5-HT receptors, synthesized in the oocytes on the template of brain mRNA, act through a common pathway that involves (a) a guanine nucleotide binding protein and (b) IP\u2083 production leading to Ca mobilization.", "doi": "10.1016/0169-328x(86)90026-4", "issn": "0169-328X", "publisher": "Elsevier", "publication": "Molecular Brain Research", "publication_date": "1986-12", "series_number": "3", "volume": "1", "issue": "3", "pages": "201-209" }, { "id": "authors:e1krd-76h54", "collection": "authors", "collection_id": "e1krd-76h54", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:GOLpnas86", "type": "article", "title": "Messenger RNA coding for only the alpha subunit of the rat brain Na channel is sufficient for expression of functional channels in Xenopus oocytes", "author": [ { "family_name": "Goldin", "given_name": "Alan L.", "clpid": "Goldin-A-L" }, { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "L\u00fcbbert", "given_name": "Hermann", "clpid": "L\u00fcbbert-H" }, { "family_name": "Dowsett", "given_name": "Andrew", "clpid": "Dowsett-A" }, { "family_name": "Marshall", "given_name": "John", "clpid": "Marshall-J" }, { "family_name": "Auld", "given_name": "Vanessa", "clpid": "Auld-V-J" }, { "family_name": "Downey", "given_name": "William", "clpid": "Downey-W" }, { "family_name": "Fritz", "given_name": "Larry C.", "clpid": "Fritz-L-C" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Dunn", "given_name": "Robert", "clpid": "Dunn-R-J" }, { "family_name": "Catterall", "given_name": "William A.", "clpid": "Catterall-W-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Several cDNA clones coding for the high molecular weight (alpha) subunit of the voltage-sensitive Na channel have been selected by immunoscreening a rat brain cDNA library constructed in the expression vector lambda gt11. As will be reported elsewhere, the amino acid sequence translated from the DNA sequence shows considerable homology to that reported for the Electrophorus electricus electroplax Na channel. Several of the cDNA inserts hybridized with a low-abundance 9-kilobase RNA species from rat brain, muscle, and heart. Sucrose-gradient fractionation of rat brain poly(A) RNA yielded a high molecular weight fraction containing this mRNA, which resulted in functional Na channels when injected into oocytes. This fraction contained undetectable amounts of low molecular weight RNA. The high molecular weight Na channel RNA was selected from rat brain poly(A) RNA by hybridization to a single-strand antisense cDNA clone. Translation of this RNA in Xenopus oocytes resulted in the appearance of tetrodotoxin-sensitive voltage-sensitive Na channels in the oocyte membrane. These results demonstrate that mRNA encoding the alpha subunit of the rat brain Na channel, in the absence of any beta-subunit mRNA, is sufficient for translation to give functional channels in oocytes.", "pmcid": "PMC386747", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1986-10-01", "series_number": "19", "volume": "83", "issue": "19", "pages": "7503-7507" }, { "id": "authors:36npf-f7j91", "collection": "authors", "collection_id": "36npf-f7j91", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:BONmcb86", "type": "article", "title": "The Drosophila melanogaster actin 5C gene uses two transcription initiation sites and three polyadenylation sites to express multiple mRNA species", "author": [ { "family_name": "Bond", "given_name": "Beverley J.", "clpid": "Bond-B-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "At least six mRNAs are made from the Drosophila melanogaster act5C gene. We investigated the structures of these RNAs in detail and determined that they are heterogeneous at both their 5' and 3' ends. At the 5' end there were two nonhomologous leader exons which were alternately spliced to the remainder of the gene. These leader exons mapped to 1.7 and 0.7 kilobases, respectively, upstream of a common splice acceptor site which was eight base pairs 5' to the translation initiator AUG. Exon 1 is 147 bases in length, while exon 2 is 111 bases. A consensus TATA sequence was found roughly 30 base pairs upstream from exon 1, but none was found in the analogous position upstream of exon 2. The transcript length diversity arose principally from the use of three polyadenylation sites. This gave rise to RNA molecules with 3'-untranslated regions of roughly 375, 655, and 945 base pairs. With two start sites and three termination sites, this gene has the potential to produce six different transcripts. All six possible transcripts were present in whole fly mRNA. Transcripts containing the two different leader exons were found in roughly the same relative quantities through development. In contrast, the various 3' ends were differentially represented through development.", "issn": "0270-7306", "publisher": "Molecular and Cellular Biology", "publication": "Molecular and Cellular Biology", "publication_date": "1986-06-01", "series_number": "6", "volume": "6", "issue": "6", "pages": "2080-2088" }, { "id": "authors:9e0yb-dq472", "collection": "authors", "collection_id": "9e0yb-dq472", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120627-102216935", "type": "article", "title": "The Memory Gene Dunce+ Encodes a Remarkable Set of RNAs with Internal Heterogeneity", "author": [ { "family_name": "Davis", "given_name": "Ronald L.", "clpid": "Davis-R-L" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We have previously isolated the region of the Drosophila melanogaster X chromosome which contains the dunce^+ gene and mapped the dunce^2 mutation by recombination to a 10- to 12-kilobase (kb) interval (R. L. Davis and N. Davidson, Mol. Cell. Biol. 4:358-367, 1984). Here, we examine the expression of the dunce^+ chromosomal region and identify the dunce^+ gene within that region. A region of ca. 25 kb which contains the 10- to 12-kb interval to which dunce^2 was mapped codes for polyadenylated RNAs of 9.6, 7.4, 7.2, 7.0, 5.4, and 4.5 kb in adult flies. These transcripts are encoded by the same DNA strand and share sequences of some exons, indicating that the transcripts arise from the same gene. Some genome probes internal to the ca. 25-kb coding region show transcript-specific hybridization, demonstrating alternate usage of exonic sequence information in the formation of the mature transcripts. The basis for this internal heterogeneity in RNAs is most likely alternative splicing. Two dunce mutants examined show aberrant RNA expression from this coding region, confirming that this region is the dunce gene. The developmental expression of these transcripts has been examined. The 5.4-kb RNA is present at all developmental stages. The 9.6-, 7.4-, 7.2-, and 7.0-kb RNAs are not expressed at detectable levels in embryos, but are detected in late embryogenesis and in later developmental stages. The 4.5-kb species is found in early embryos and adults, but not in intermediate stages. We discuss the remarkable transcript heterogeneity and expression pattern with respect to the important function this gene performs in neurobiological and other physiological processes.", "doi": "10.1128/MCB.6.5.1464", "pmcid": "PMC367671", "issn": "0270-7306", "publisher": "American Society for Microbiology", "publication": "Molecular and Cellular Biology", "publication_date": "1986-05", "series_number": "5", "volume": "6", "issue": "5", "pages": "1464-1470" }, { "id": "authors:9xcfz-bpy60", "collection": "authors", "collection_id": "9xcfz-bpy60", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:YULnar86", "type": "article", "title": "Mouse muscle nicotinic acetylcholine receptor gamma subunit: cDNA sequence and gene expression", "author": [ { "family_name": "Yu", "given_name": "Lei", "clpid": "Yu-L" }, { "family_name": "LaPolla", "given_name": "Robert J.", "clpid": "LaPolla-R-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Clones coding for the mouse nicotinic acetylcholine receptor (AChR) gamma subunit precursor have been selected from a cDNA library derived from a mouse myogenic cell line and sequenced. The deduced protein sequence consists of a signal peptide of 22 amino acid residues and a mature gamma subunit of 497 amino acid residues. There is a high degree of sequence conservation between this mouse sequence and published human and calf AChR gamma subunits and, after allowing for functional amino acid substitutions, also to the more distantly related chicken and Torpedo AChR gamma subunits. The degree of sequence conservation is especially high in the four putative hydrophobic membrane spanning regions, supporting the assignment of these domains. RNA blot hybridization showed that the mRNA level of the gamma subunit increases by 30 fold or more upon differentiation of the two mouse myogenic cell lines, BC3H-1 and C2C12, suggesting that the primary controls for changes in gene expression during differentiation are at the level of transcription. One cDNA clone was found to correspond to a partially processed nuclear transcript containing two as yet unspliced intervening sequences.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1986-04-25", "series_number": "8", "volume": "14", "issue": "8", "pages": "3539-3555" }, { "id": "authors:ch006-z4810", "collection": "authors", "collection_id": "ch006-z4810", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:ROZpnas86", "type": "article", "title": "Differential Processing of RNA Transcribed from the Single-Copy Drosophila Myosin Heavy Chain Gene Produces Four mRNAs That Encode Two Polypeptides", "author": [ { "family_name": "Rozek", "given_name": "Charles E.", "clpid": "Rozek-C-E" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We report the sequence of genomic DNA at the 3' end of the single-copy Drosophila myosin heavy chain (MHC) gene and the structure and sequence at the 3' end of four MHC mRNAs. Two mRNAs, 7.2 kilobases (kb) and 8.0 kb in length, are expressed in all stages of development in which detectable levels of muscle-specific mRNAs accumulate. These mRNAs differ by alternate choice of two poly(A) sites within the same exon. Sequence information predicts that these two mRNAs can encode one MHC polypeptide. Two additional MHC mRNAs, 8.0 kb and 8.6 kb in length, are expressed only in late pupal and adult stages of development. These two stage-specific MHC mRNAs use the same poly(A) sites as the MHC mRNAs described above but have a different splicing pattern and thus include an additional exon. Sequence information predicts that these two stage-specific MHC mRNAs encode a second MHC polypeptide with a different COOH terminus.", "doi": "10.1073/pnas.83.7.2128", "pmcid": "PMC323244", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1986-04-01", "series_number": "7", "volume": "83", "issue": "7", "pages": "2128-2132" }, { "id": "authors:70sjs-3ja37", "collection": "authors", "collection_id": "70sjs-3ja37", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201012-152226204", "type": "article", "title": "Expression and modulation of voltage-gated calcium channels after RNA injection in Xenopus oocytes", "author": [ { "family_name": "Dascal", "given_name": "Nathan", "clpid": "Dascal-N" }, { "family_name": "Snutch", "given_name": "Terry P.", "clpid": "Snutch-T-P" }, { "family_name": "L\u00fcbbert", "given_name": "Hermann", "clpid": "L\u00fcbbert-H" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" } ], "abstract": "Calcium ions flow into cells through several distinct classes of voltage-dependent calcium-selective channels. Such fluxes play important roles in electrical signaling at the cell membrane and in chemical signaling within cells. Further information about calcium channels was obtained by injecting RNA isolated from rat brain, heart and skeletal muscle into Xenopus oocytes. Macroscopic currents through voltage-operated calcium channels were resolved when the endogenous calcium-dependent chloride current was blocked by replacing external calcium with barium and chloride with methanesulfonate. The resulting barium current was insensitive to tetrodotoxin but was completely blocked by cadmium or cobalt. With both heart and brain RNA at least two distinct types of calcium ion conductance were found, distinguishable by their time course and inactivation properties. In oocytes injected with heart RNA, the slowly inactivating component was selectively blocked by the calcium-channel antagonist nifedipine. Barium ion currents induced by heart RNA were modulated by isoproterenol, cyclic adenosine monophosphate, and acetylcholine.", "doi": "10.1126/science.2418503", "issn": "0036-8075", "publisher": "American Association for the Advancement of Science", "publication": "Science", "publication_date": "1986-03-07", "series_number": "4742", "volume": "231", "issue": "4742", "pages": "1147-1150" }, { "id": "authors:7vex3-ajh92", "collection": "authors", "collection_id": "7vex3-ajh92", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HUMmcb86", "type": "article", "title": "The complete sequence of the mouse skeletal alpha-actin gene reveals several conserved and inverted repeat sequences outside of the protein-coding region", "author": [ { "family_name": "Hu", "given_name": "Mickey Chien-Tsung", "clpid": "Hu-M-C-T" }, { "family_name": "Sharp", "given_name": "Sandra B.", "clpid": "Sharp-S-B" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The complete nucleotide sequence of a genomic clone encoding the mouse skeletal alpha-actin gene has been determined. This single-copy gene codes for a protein identical in primary sequence to the rabbit skeletal alpha-actin. It has a large intron in the 5'-untranslated region 12 nucleotides upstream from the initiator ATG and five small introns in the coding region at codons specifying amino acids 41/42, 150, 204, 267, and 327/328. These intron positions are identical to those for the corresponding genes of chickens and rats. Similar to other skeletal alpha-actin genes, the nucleotide sequence codes for two amino acids, Met-Cys, preceding the known N-terminal Asp of the mature protein. Comparison of the nucleotide sequences of rat, mouse, chicken, and human skeletal muscle alpha-actin genes reveals conserved sequences (some not previously noted) outside of the protein-coding region. Furthermore, several inverted repeat sequences, partially within these conserved regions, have been identified. These sequences are not present in the vertebrate cytoskeletal beta-actin genes. The strong conservation of the inverted repeat sequences suggests that they may have a role in the tissue-specific expression of skeletal alpha-actin genes.", "issn": "0270-7306", "publisher": "Molecular and Cellular Biology", "publication": "Molecular and Cellular Biology", "publication_date": "1986-01-01", "series_number": "1", "volume": "6", "issue": "1", "pages": "15-25" }, { "id": "authors:8q48k-1fg57", "collection": "authors", "collection_id": "8q48k-1fg57", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20161213-103357427", "type": "article", "title": "High resolution mapping of in situ hybridized biotinylated DNA to surface-spread Drosophila polytene chromosomes", "author": [ { "family_name": "Kress", "given_name": "Horst", "clpid": "Kress-H" }, { "family_name": "Meyerowitz", "given_name": "Elliot M.", "orcid": "0000-0003-4798-5153", "clpid": "Meyerowitz-E-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We describe a method of mapping genes or transcripts on polytene chromosomes by transmission electron microscopy. We present several applications which illustrate that, in favorable cases, the method has a resolution of ca. 10 kb, and that high resolution mapping of hybridization sites relative to bands and puffs can be achieved. We mapped sites of transcription for poly-(A) RNA and present evidence which shows that these sites are localized in some bands and puffs, but are also found in interbands.", "doi": "10.1007/BF00293158", "issn": "0009-5915", "publisher": "Springer", "publication": "Chromosoma", "publication_date": "1985-11", "series_number": "2", "volume": "93", "issue": "2", "pages": "113-122" }, { "id": "authors:xvgzc-yzg93", "collection": "authors", "collection_id": "xvgzc-yzg93", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120628-135315838", "type": "article", "title": "Characterization of the Myosin Light-Chain-2 Gene of\n Drosophila melanogaster", "author": [ { "family_name": "Parker", "given_name": "Vann P.", "clpid": "Parker-V-P" }, { "family_name": "Falkenthal", "given_name": "Scott", "clpid": "Falkenthal-S" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Recombinant DNA clones encoding the Drosophila melanogaster homolog of the vertebrate myosin light-chain-2 (MLC-2) gene have been isolated. This single-copy gene maps to the chromosomal locus 99E. The nucleotide sequence was determined for a 3.4-kilobase genomic fragment containing the gene and for two MLC-2 cDNA clones generated from late pupal mRNA. Comparison of these sequences shows that the gene contains two introns, the positions of which are conserved in the corresponding rat sequence. Extension of a primer homologous to the mRNA reveals two start sites for transcription 12 nucleotides apart. The sequence TATA is not present ahead of the mRNA cap site. There are two major sites of poly(A) addition separated by 356 nucleotides. The protein sequence derived from translation of the cDNA sequence shows a high degree of homology with that for the DTNB myosin light chain (MLC-2) of chicken. A lower degree of sequence homology was seen in comparisons with other evolutionarily related calcium-binding proteins. RNA blots show high levels of expression of several transcripts during the developmental time stages when muscle is being produced. In vitro translation of hybrid-selected RNA produces two polypeptides which comigrate on two-dimensional gels with proteins from Drosophila actomyosin, although the cDNA sequence reveals only one 26-kilodalton primary translation product.", "doi": "10.1128/MCB.5.11.3058", "pmcid": "PMC369119", "issn": "0270-7306", "publisher": "American Society for Microbiology", "publication": "Molecular and Cellular Biology", "publication_date": "1985-11", "series_number": "11", "volume": "5", "issue": "11", "pages": "3058-3068" }, { "id": "authors:te5qt-8e375", "collection": "authors", "collection_id": "te5qt-8e375", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:WHIpnas85", "type": "article", "title": "Mouse-Torpedo Hybrid Acetylcholine Receptors: Functional Homology Does not Equal Sequence Homology", "author": [ { "family_name": "White", "given_name": "Michael M.", "clpid": "White-M-M" }, { "family_name": "Mayne", "given_name": "Katharine Mixter", "clpid": "Mayne-K-M" }, { "family_name": "Lester", "given_name": "Henry A.", "orcid": "0000-0002-5470-5255", "clpid": "Lester-H-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The nicotinic acetylcholine (AcCho) receptor (AcChoR) is a multisubunit protein complex of stoichiometry alpha 2\u00df gamma delta . The several subunits show homology with each other within a given species; in addition, homology is found between analogous subunits between species. We have used the phage SP6 RNA polymerase transcription system to produce single-species RNA in vitro for various AcChoR subunits from cDNAs. Injection of an equimolar mixture of RNA for the alpha, \u00df, gamma, and delta subunits of Torpedo californica AcChoR into Xenopus oocytes results in the appearance of functional receptors in the oocyte membrane. No response to AcCho is detected when the \u00df or gamma subunit RNA is omitted, and a small response is seen when the delta subunit RNA is omitted. Replacement of Torpedo delta subunit RNA by the mouse BC3H-1 cell line AcChoR delta subunit RNA leads to the formation of functional receptors that show a 3-4-fold greater response to AcCho than does the full Torpedo complex. No response is seen when the mouse delta RNA replaces Torpedo gamma RNA. By amino acid homology profile comparisons, the mouse delta subunit appears to be moderately but not highly similar to the Torpedo delta subunit; the apparent similarity to the Torpedo gamma subunit is only slightly less. Therefore, the features of the primary sequence that determine the functional delta character of the mouse polypeptide are not revealed by simple homology comparisons.", "pmcid": "PMC391003", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1985-07-15", "series_number": "14", "volume": "82", "issue": "14", "pages": "4852-4856" }, { "id": "authors:w1q11-kcd29", "collection": "authors", "collection_id": "w1q11-kcd29", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:FALpnas85", "type": "article", "title": "Developmental variations in the splicing pattern of transcripts from the Drosophila gene encoding myosin alkali light chain result in different carboxyl-terminal amino acid sequences", "author": [ { "family_name": "Falkenthal", "given_name": "Scott", "clpid": "Falkenthal-S" }, { "family_name": "Parker", "given_name": "Vann P.", "clpid": "Parker-V-P" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The total sequence of the Drosophila melanogaster gene encoding the myosin light chain dissociated by alkali (MLC-ALK) has been determined. By sequence comparisons with an MLC-ALK cDNA clone and by S1 nuclease analyses, the pattern of introns and exons within the gene has been deduced. There are multiple polyadenylylation signals that can account for most of the observed heterogeneity in the lengths of mRNAs. In the 3' half of the gene, there are two alternative splicing patterns which result in mRNAs that translate to give proteins with two alternative 14 amino acid carboxyl-terminal sequences. There is developmental regulation of the selection of the above splicing sites. One splicing pattern produces an mRNA that translates into a protein used for both larval and adult musculature, whereas the other splicing pattern is used for the latter stage only.", "doi": "10.1073/pnas.82.2.449", "pmcid": "PMC397056", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1985-01-15", "series_number": "2", "volume": "82", "issue": "2", "pages": "449-453" }, { "id": "authors:j87md-72316", "collection": "authors", "collection_id": "j87md-72316", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:LAPpnas84", "type": "article", "title": "Isolation and characterization of a cDNA clone for the complete protein coding region of the delta-subunit of the mouse acetylcholine receptor", "author": [ { "family_name": "LaPolla", "given_name": "Robert J.", "clpid": "LaPolla-R-J" }, { "family_name": "Mayne", "given_name": "Katharine Mixter", "clpid": "Mayne-K-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the \u03b4 subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector \u03bbgt10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the \u03b4 clone was selected by hybridization with cDNA encoding the \u03b3 subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR \u03b4 and \u03b3 subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo \u03b3 subunit cDNA, but not with \u03b4. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences.", "doi": "10.1073/pnas.81.24.7970", "pmcid": "PMC392275", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1984-12-15", "series_number": "24", "volume": "81", "issue": "24", "pages": "7970-7974" }, { "id": "authors:xgtzs-cp437", "collection": "authors", "collection_id": "xgtzs-cp437", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:MATmcb84", "type": "article", "title": "Isolation and characterization of the Beadex locus of Drosophila melanogaster: a putative cis-acting negative regulatory element for the heldup-a gene", "author": [ { "family_name": "Mattox", "given_name": "William W.", "clpid": "Mattox-W-W" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We isolated recombinant lambda phage clones spanning 49 kilobases of DNA which contain the Beadex and heldup-a loci of Drosophila melanogaster. These cloned DNAs were used to analyze the structure of eight dominant mutant alleles of the Beadex locus which show increased gene activity. A region, only 700 base pairs in length, is altered in each of these mutants. Six of the mutations have DNA insertions within this segment. Most of these insertions resemble retrovirus-like transposable elements. In one case (Beadex2) the inserted sequences are homologous to the gypsy transposon family. The other two Beadex alleles were induced by hybrid dysgenesis and suffered deletions which included at least part of the 700-base-pair segment. These deletions appear to have resulted from imprecise excision or deletion of a nearby P element found in the wild-type parental strain. Analysis of one heldup-a allele (heldup-aD30r) indicates that a similar P element-mediated event is responsible for this lesion. In this mutant, deletion of sequences no more than 1,600 base pairs from the Beadex locus accompanies the loss of heldup-a function. The deleted sequences in heldup-aD30r include the entire 700-base-pair segment within which at least part of the Beadex locus resides, yet these flies have no Beadex phenotype. This indicates that a functional heldup-a gene is necessary for expression of the Beadex phenotype. Together, these results suggest that the Beadex functional domain is contained within a short segment of DNA near the heldup-a gene and support the hypothesis that the Beadex locus functions as a cis-acting negative regulatory element for the heldup-a gene.", "issn": "0270-7306", "publisher": "Molecular and Cellular Biology", "publication": "Molecular and Cellular Biology", "publication_date": "1984-07-01", "series_number": "7", "volume": "4", "issue": "7", "pages": "1343-1353" }, { "id": "authors:ycppa-8te28", "collection": "authors", "collection_id": "ycppa-8te28", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:FALmcb84", "type": "article", "title": "Drosophila melanogaster has only one myosin alkali light-chain gene which encodes a protein with considerable amino acid sequence homology to chicken myosin alkali light chains", "author": [ { "family_name": "Falkenthal", "given_name": "Scott", "clpid": "Falkenthal-S" }, { "family_name": "Parker", "given_name": "Vann P.", "clpid": "Parker-V-P" }, { "family_name": "Mattox", "given_name": "William W.", "clpid": "Mattox-W-W" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A chimeric lambda DNA molecule containing the myosin alkali light-chain gene of Drosophila melanogaster was isolated. The encoded amino acid sequence was determined from the nucleic acid sequence of a cDNA homologous to the genomic clone. The identity of the encoded protein was established by two criteria: (i) sequence homology with the chicken alkali light-chain proteins and (ii) comparison of the two-dimensional gel electrophoretic pattern of the peptides synthesized by in vitro translation of hybrid-selected RNA to that of myosin alkali light-chain peptides extracted from Drosophila myofibrils. There is only one myosin alkali light-chain in D. melanogaster; its chromosomal location is region 98B. This gene is abundantly expressed during the development of larval as well as adult muscles. The Drosophila protein appears to contain one putative divalent cation-binding domain (an EF hand) as compared with the three EF hands present in chicken alkali light chains.", "issn": "0270-7306", "publisher": "Molecular and Cellular Biology", "publication": "Molecular and Cellular Biology", "publication_date": "1984-05-01", "series_number": "5", "volume": "4", "issue": "5", "pages": "956-965" }, { "id": "authors:6jrpn-4xn72", "collection": "authors", "collection_id": "6jrpn-4xn72", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20190222-114016813", "type": "article", "title": "Stage-specific regulation of actin genes in Drosophila wing cells", "author": [ { "family_name": "Petersen", "given_name": "Nancy S.", "clpid": "Petersen-N-S" }, { "family_name": "Bond", "given_name": "Beverly J.", "clpid": "Bond-B-J" }, { "family_name": "Mitchell", "given_name": "Herschel K.", "clpid": "Mitchell-H-K" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Extreme and rapid changes in the synthesis of messenger RNAs and proteins accompany differentiation in wing tissues of Drosophila. Of the six actin genes, at least three are expressed in wing cells, some during the most extreme changes in cell shape. However, different messages of the set appear, decay, and reappear on a regulated temporal program. These results show that actin expression is stage\u2010specific in a single cell type.", "doi": "10.1002/dvg.1020050405", "issn": "0192-253X", "publisher": "Wiley", "publication": "Developmental Genetics", "publication_date": "1984-04", "series_number": "4", "volume": "5", "issue": "4", "pages": "219-225" }, { "id": "authors:6jwax-y9y74", "collection": "authors", "collection_id": "6jwax-y9y74", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120629-110348691", "type": "article", "title": "Isolation of the Drosophila melanogaster dunce chromosomal region and recombinational mapping of dunce sequences with restriction site polymorphisms as genetic markers", "author": [ { "family_name": "Davis", "given_name": "Ronald L.", "clpid": "Davis-R-L" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Using the method of chromosomal walking, we have isolated a contiguous region of the Drosophila melanogaster X chromosome which corresponds to salivary gland chromosome bands 3C12 to 3D4. This five-band region contains approximately 100 kilobases of DNA, including those sequences comprising dunce, a gene which functions in memory and cyclic nucleotide metabolism. Genome blots of DNA from flies carrying several different chromosomal aberrations with breakpoints in the region have been probed with the isolated clones to map the breakpoints on the cloned DNA and to delimit dunce sequences. This has localized dunce to a 50-kilobase region. In addition, we have searched this 50-kilobase region for restriction site polymorphisms between X chromosomes from different Drosophila strains by genome blotting experiments, and we have followed the segregation of detected polymorphisms and dunce alleles after meiotic recombination. The data map one dunce mutation between two polymorphisms located 10 to 12 kilobases apart.", "doi": "10.1128/MCB.4.2.358", "pmcid": "PMC368703", "issn": "0270-7306", "publisher": "American Society for Microbiology", "publication": "Molecular and Cellular Biology", "publication_date": "1984-02", "series_number": "2", "volume": "4", "issue": "2", "pages": "358-367" }, { "id": "authors:czmtj-rf384", "collection": "authors", "collection_id": "czmtj-rf384", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:SNYpnas82", "type": "article", "title": "A transposable element that splits the promoter region inactivates a Drosophila cuticle protein gene", "author": [ { "family_name": "Snyder", "given_name": "Michael P.", "clpid": "Snyder-M-P" }, { "family_name": "Kimbrell", "given_name": "Deborah", "clpid": "Kimbrell-D" }, { "family_name": "Hunkapiller", "given_name": "Michael", "clpid": "Hunkapiller-M-W" }, { "family_name": "Hill", "given_name": "Ron", "clpid": "Hill-R" }, { "family_name": "Fristrom", "given_name": "James", "clpid": "Fristrom-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Two mutations that affect larval cuticle protein gene expression in the 2/3 variant Drosophila melanogaster strain were investigated. We demonstrate that this strain synthesizes an electrophoretic variant, fast 2 (CPf2), of wild-type cuticle protein 2 (CP2). It also lacks detectable amounts of cuticle protein 3 (CP3). The other major cuticle proteins are still present. Protein and DNA sequence analyses indicate that point mutations cause two amino acid substitutions that change the electrophoretic mobility of CPf2 relative to that of CP2. The mutation abolishing the expression of CP3 was found to be a 7.3-kilobase DNA insertion located within the T-A-T-A box region of this gene, at -31 base pairs from the mRNA start site. This DNA insertion, called H.M.S. Beagle, belongs to a conserved family of repeated DNA elements that have characteristics similar to those of previously characterized Drosophila transposable elements. H.M.S. Beagle elements are repeated approximately 50 times in the haploid genome and exhibit restriction fragment-length polymorphisms around points of insertion between Canton S, Oregon R, and 2/3 Drosophila strains. Sequence analysis indicates that H.M.S. Beagle contains 266-base-pair direct repeats at its termini and is flanked by a duplication of 4 base pairs of target DNA sequence, T-A-T-A, in the CP3 gene insertion. Thus, insertion of a transposable element into the putative promoter region of the CP3 gene is evidently responsible for inactivating CP3 gene expression.", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1982-12-01", "series_number": "23", "volume": "79", "issue": "23", "pages": "7430-7434" }, { "id": "authors:gven7-x9r66", "collection": "authors", "collection_id": "gven7-x9r66", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20150204-152008392", "type": "article", "title": "Identification of a BALB/c H-2L^d gene by DNA-mediated gene transfer", "author": [ { "family_name": "Goodenow", "given_name": "Robert S.", "clpid": "Goodenow-R-S" }, { "family_name": "McMillan", "given_name": "Minnie", "clpid": "McMillan-M" }, { "family_name": "\u00d6rn", "given_name": "Anders", "clpid": "\u00d6rn-A" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Frelinger", "given_name": "Jeffrey A.", "clpid": "Frelinger-J-A" }, { "family_name": "Hood", "given_name": "Leroy", "orcid": "0000-0001-7158-3678", "clpid": "Hood-L-E" } ], "abstract": "Gene transfer and immunoselection were used in the identification of a BALB/c genomic clone containing an H-2L^d gene (clone 27.5). Transformation of thymidine kinase-negative C3H mouse L cells with the cloned 27.5 DNA together with the herpes simplex virus tk gene produced transformants expressing L^d molecules detected by radioimmune assay with monoclonal hybridoma antibodies to Ld antigens. The foreign L^d gene products expressed by cloned mouse L cell transformants were shown to be virtually indistinguishable from BALB/c spleen L^d molecules by two-dimensional electrophoretic analysis of H-2L^d immunoprecipitates. These results indicate that the genomic clone 27.5 contains a functional BALB/c H-2L^d gene and demonstrate the usefulness of this approach for identifying the gene products encoded by cloned genes which are members of a multigene family. Furthermore, the ability to place cell-surface recognition molecules on the surfaces of foreign cells provides a powerful opportunity for functional analyses of these molecules.", "doi": "10.1126/science.7058331", "issn": "0036-8075", "publisher": "American Association for the Advancement of Science", "publication": "Science", "publication_date": "1982-02-05", "series_number": "4533", "volume": "215", "issue": "4533", "pages": "677-679" }, { "id": "authors:8qssc-t7339", "collection": "authors", "collection_id": "8qssc-t7339", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:CASpnas81", "type": "article", "title": "The U3 Portion of Feline Leukemia Virus DNA Identifies Horizontally Acquired Proviruses in Leukemic Cats", "author": [ { "family_name": "Casey", "given_name": "James W.", "clpid": "Casey-J-W" }, { "family_name": "Roach", "given_name": "Arthur", "clpid": "Roach-A-H" }, { "family_name": "Mullins", "given_name": "James I.", "clpid": "Mullins-J-I" }, { "family_name": "Burck", "given_name": "Kathy Bauman", "clpid": "Burck-K-B" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "Gardner", "given_name": "Murray B.", "clpid": "Gardner-M-B" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The presence and location of DNA sequences related to the U3 and U5 portions of the infectious exogenous feline leukemia virus (FeLV) long terminal repeat (LTR) in various cat DNAs have been determined by hybridization experiments. In uninfected cat DNAs, the U5 LTR segment from the Gardner-Arnstein strain B virus is present at approximately 150 copies per cell. This level is approximately 10-fold greater than that of endogenous internal FeLV sequences. The U5 sequences differ in copy number and, to some extent, in location from one animal to another. For any one animal, the sequence organization of the U5 segments is the same among different tissues, showing that the pattern is inherited through the germ line. Most importantly, the viral U3 LTR probe hybridizes only very weakly with uninfected cat DNAs. Both the U3 and the U5 regions of the LTR from the Gardner-Arnstein strain of virus cross-hybridize with DNA derived from four other infectious FeLVs representing A, B, and C subtypes. Thus, the U3 region may be used as a probe for studying the number and location of exogenously acquired FeLV proviruses in infected cat tissues. In some cases exogenously acquired proviruses are present in unique sites in the genome of virus-positive cat lymphosarcomas, indicating a monoclonal origin for the tumor. In other tumors, the proviral sequences are randomly distributed over many sites. Lymphosarcomas of virus-negative cats have no exogenous U3 sequences despite epidemiological evidence of an association of virus-negative leukemia with exposure to FeLV.", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1981-12-01", "series_number": "12", "volume": "78", "issue": "12", "pages": "7778-7782" }, { "id": "authors:cdz91-y4443", "collection": "authors", "collection_id": "cdz91-y4443", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:WUMpnas81", "type": "article", "title": "Transmission electron microscopic method for gene mapping on polytene chromosomes by in situ hybridization", "author": [ { "family_name": "Wu", "given_name": "Madeline", "clpid": "Wu-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A transmission electron microscope method for gene mapping by in situ hybridization to Drosophila polytene chromosomes has been developed. As electron-opaque labels, we use colloidal gold spheres having a diameter of 25 nm. The spheres are coated with a layer of protein to which Escherichia coli single-stranded DNA is photochemically crosslinked. Poly(dT) tails are added to the 3' OH ends of these DNA strands, and poly(dA) tails are added to the 3' OH ends of a fragmented cloned Drosophila DNA. These probe-dA strands are hybridized in situ to polytene chromosome squashes. Gold spheres are linked to the hybridized probe-dA strands by A\u00b7 T base pairing. The sphere positions relative to the chromosome bands can be observed by transmission electron microscopy. The method shows low background and high resolution.", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1981-11-01", "series_number": "11", "volume": "78", "issue": "11", "pages": "7059-7063" }, { "id": "authors:wjya2-50k33", "collection": "authors", "collection_id": "wjya2-50k33", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:COHpnas81", "type": "article", "title": "Baboon endogenous virus genome: Molecular cloning and structural characterization of nondefective viral genomes from DNA of a baboon cell strain", "author": [ { "family_name": "Cohen", "given_name": "Maurice", "clpid": "Cohen-Maurice" }, { "family_name": "Rein", "given_name": "Alan", "clpid": "Rein-Alan" }, { "family_name": "Stephens", "given_name": "Robert M.", "clpid": "Stephens-R-M" }, { "family_name": "O'Connell", "given_name": "Catherine", "clpid": "O'Connell-C" }, { "family_name": "Gilden", "given_name": "Raymond V.", "clpid": "Gilden-R-V" }, { "family_name": "Shure", "given_name": "Mavis", "clpid": "Shure-M" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "McAllister", "given_name": "Robert M.", "clpid": "McAllister-R-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Several heterogeneities in the baboon endogenous virus (BaEV) genomes that are present in the DNA of normal baboon tissues and the baboon cell strain BEF-3 have been described previously. To study these genomes, we cloned BaEV proviruses from BEF-3 cellular DNA into the vector Charon 4A. Of the four full-length clones isolated, one was nondefective as determined by transfection. The sequence of a portion of this clone was found to code for amino acids 61-91 in the p30 region of the gag gene. This identification allowed us to align the restriction map with the BaEV genetic map. One heterogeneity, a BamHI site 2.4 kilobases (kb) from the proviral 5' end, was located close to the gag-pol junction; another, a BamHI site 1.4 kb from the 5' end of the genome, corresponded to the gag p30 coding sequence for amino acids 32-34; and a third, a Xho I site, was near the 3' end of the pol gene. To select the nondefective BaEV genomes from BEF-3 cells, we infected permissive cells with virus produced by BEF-3 cells and also transfected BEF-3 cellular DNA into permissive cells. The BaEV genomes in the permissive recipient cultures were then analyzed by restriction enzyme analysis. These nondefective genomes were found to be heterogeneous with respect to the gag-pol BamHI site and the Xho I site, but all were found to contain the BamHI site 1.4 kb from the 5' end of the genome.", "doi": "10.1073/pnas.78.8.5207", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1981-08", "series_number": "8", "volume": "78", "issue": "8", "pages": "5207-5211" }, { "id": "authors:31y9s-52270", "collection": "authors", "collection_id": "31y9s-52270", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HIRmcb81", "type": "article", "title": "Isolation and characterization of the dopa decarboxylase gene of Drosophila melanogaster", "author": [ { "family_name": "Hirsh", "given_name": "Jay", "clpid": "Hirsh-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We have isolated chromosomal deoxyribonucleic acid clones containing the Drosophila dopa decarboxylase gene. We describe an isolation procedure which can be applied to other nonabundantly expressed Drosophila genes. The dopa decarboxylase gene lies within or very near polytene chromosome band 37C1-2. The gene is interrupted by at least one intron, and the primary mode of regulation is pretranslational. At least two additional sequences hybridized by in vivo ribonucleic acid-derived probes are found within a 35-kilobase region surrounding the gene. The developmental profile of ribonucleic acid transcribed from one of these regions differs from that of the dopa decarboxylase transcript.", "issn": "0270-7306", "publisher": "Molecular and Cellular Biology", "publication": "Molecular and Cellular Biology", "publication_date": "1981-06-01", "series_number": "6", "volume": "1", "issue": "6", "pages": "475-485" }, { "id": "authors:k5b7k-x8t17", "collection": "authors", "collection_id": "k5b7k-x8t17", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:MULjvir81", "type": "article", "title": "Sequence arrangement and biological activity of cloned feline leukemia virus proviruses from a virus-productive human cell line", "author": [ { "family_name": "Mullins", "given_name": "James I.", "clpid": "Mullins-J-I" }, { "family_name": "Casey", "given_name": "James W.", "clpid": "Casey-J-W" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "Burck", "given_name": "Kathy Bauman", "clpid": "Burck-K-B" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "We examined 14 different feline leukemia virus proviruses from the productively infected human cell line RD(FeLV)-2 after cloning in the modified lambda vector Charon 4A. Each isolate was characterized by restriction digestion and Southern blot analysis. The DNA of each isolate was tested for competence to express virus after uptake by sensitive animal cells (transfection). All but one isolate contained an apparently complete provirus, but only four were infectious. Seven isolates (four noninfectious, three infectious) were studied by heteroduplexing followed by electron microscopy or by S1 nuclease treatment and gel electrophoresis. No regions of nonhomology between proviruses were detected by either criterion, and in no case did we observe homology between flanking sequences. Random shearing or removal of flanking sequences by S1 nuclease had no effect on the status of infectivity of the clones. Thus, we were unable to find molecular differences between infectious and noninfectious proviruses. Our data are consistent with either of the following hypotheses: (i) that there is a short host sequence which is essential as a promoter for virus expression; or (ii) that lack of infectivity is due to small mutations within the proviral genome.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1981-05-01", "series_number": "2", "volume": "38", "issue": "2", "pages": "688-703" }, { "id": "authors:ywwrh-3gt71", "collection": "authors", "collection_id": "ywwrh-3gt71", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20150127-091804479", "type": "article", "title": "Determination of cellular RNA concentrations by electron microscopy of R loop-containing DNA", "author": [ { "family_name": "Kaback", "given_name": "David B.", "clpid": "Kaback-D-B" }, { "family_name": "Rosbash", "given_name": "Michael", "clpid": "Rosbash-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "R loop hybridizations and electron microscopy have been used to determine cellular RNA concentrations for cloned genes. In plasmid DNA sequence excess, all the complementary RNA is driven into R loop structures that can be assayed by electron microscopy. To determine the concentration of a particular poly(A)+ RNA, plasmid DNA crosslinked once every 2000-5000 base pairs with trioxsalen and UV light is hybridized in DNA sequence excess to various known amounts of total poly(A)+ RNA, and the R loops are stabilized by treatment with glyoxal. If necessary, excess nonhybridized RNA is removed by Sepharose 2B chromatography, which enables the visualization of less abundant transcripts. Reconstruction experiments demonstrated that electron microscopic determination of the fraction of plasmid DNA molecules containing specific RNA loops gives accurate values of specific RNA weight fractions or concentrations in the total poly(A)+ RNA populations. These methods were also used to determine the concentrations of five RNA species complementary to sequences on TRT3, a recombinant DNA plasmid containing yeast histone 2A and 2B genes and three other nonhistone genes. The methods described allow one to visualize the R loop structures for both abundant and nonabundant transcripts and to estimate concentrations of these RNA species simply by determining the fraction of DNA containing R loops.", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1981-05", "series_number": "5", "volume": "78", "issue": "5", "pages": "2820-2824" }, { "id": "authors:b3h9m-bbq23", "collection": "authors", "collection_id": "b3h9m-bbq23", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20190501-163158818", "type": "article", "title": "The actin genes of drosophila: Protein coding regions are highly conserved but intron positions are not", "author": [ { "family_name": "Fyrberg", "given_name": "Eric A.", "clpid": "Fyrberg-E-A" }, { "family_name": "Bond", "given_name": "Beverley J.", "clpid": "Bond-B-J" }, { "family_name": "Hershey", "given_name": "N. Davis", "clpid": "Hershey-N-D" }, { "family_name": "Mixter", "given_name": "Katharine S.", "clpid": "Mixter-K-S" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The entire set of six closely related Drosophila actin genes was isolated using recombinant DNA methodology, and the structures of the respective coding regions were characterized by gene mapping techniques and by nucleotide sequencing of selected portions. Structural comparisons of these genes have resulted in several unexpected findings. Most striking is the nonconservation of the positions of intervening sequences within the protein-encoding regions of these genes. One of the Drosophila actin genes, DmA4, is split within a glycine codon at position 13; none of the remaining five genes is interrupted in the analogous position. Another gene, DmA6, is split within a glycine codon at position 307; at least two of the Drosophila actin genes are not split in the analogous position. Additionally, none of the Drosophila actin genes is split within codon four, where the yeast actin gene is interrupted. The six Drosophila actin genes encode several different proteins, but the amino acid sequence of each is similar to that of vertebrate cytoplasmic actins. None of the genes encodes a protein comparable in primary sequence to vertebrate skeletal muscle actin. Surprisingly, in each of these derived actin amino acid sequences the initiator methionine is directly followed by a cysteine residue, which in turn precedes the string of three acidic amino acids characteristic of the amino termini of mature vertebrate cytoplasmic actins. We discuss these findings in the context of actin gene evolution and function.", "doi": "10.1016/0092-8674(81)90506-7", "issn": "0092-8674", "publisher": "Elsevier", "publication": "Cell", "publication_date": "1981-04", "series_number": "1", "volume": "24", "issue": "1", "pages": "107-116" }, { "id": "authors:j2f99-23c66", "collection": "authors", "collection_id": "j2f99-23c66", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HERnar80", "type": "article", "title": "Two Drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F", "author": [ { "family_name": "Hershey", "given_name": "N. Davis", "clpid": "Hershey-N-D" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "One Drosophila melanogaster tRNAGly gene occurs on each 1.1 \u2013 2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1980-11-11", "series_number": "21", "volume": "8", "issue": "21", "pages": "4899-4910" }, { "id": "authors:wfekg-n5m81", "collection": "authors", "collection_id": "wfekg-n5m81", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:COHnar80", "type": "article", "title": "The baboon endogenous virus genome. II. Provirus sequence variations in baboon cell DNA", "author": [ { "family_name": "Cohen", "given_name": "Maurice", "clpid": "Cohen-Maurice" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Gilden", "given_name": "Raymond V.", "clpid": "Gilden-R-V" }, { "family_name": "McAllister", "given_name": "Robert M.", "clpid": "McAllister-R-M" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "Stephens", "given_name": "Robert M.", "clpid": "Stephens-R-M" } ], "abstract": "Restriction analysis of the approximately 100 integrated baboon endogenous virus (BaEV) proviruses in baboon cells and tissues has revealed two major sequence variations, both in the gag gene region of the genome. One, a 150 nucleotide pair insert, is present in a small proportion of the proviral DNAs of some baboons, but is present in the majority of the proviral DNAs of other baboons. The second, a Bam HI recognition sequence located 2.25 kb from the proviral 5' end, is missing or modified in approximately one-half of the integrated genomes. We consider the possibility that accumulation of proviruses not containing the 0.15 kb insert is correlated with viral activation and expression since it is this form that is a replication intermediate in freshly infected permissive cells. It is evident from these initial studies that the organization of the multiple BaEV proviruses in baboon DNA has undergone modification during evolution.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1980-10-10", "series_number": "19", "volume": "8", "issue": "19", "pages": "4423-4440" }, { "id": "authors:djbqe-n7a93", "collection": "authors", "collection_id": "djbqe-n7a93", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:MULnar80", "type": "article", "title": "Sequence organization of feline leukemis virus DNA in infected cells", "author": [ { "family_name": "Mullins", "given_name": "James I.", "clpid": "Mullins-J-I" }, { "family_name": "Casey", "given_name": "James W.", "clpid": "Casey-J-W" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A restriction site map has been deduced of unintegrated and integrated FeLV viral DNA found in human RD cells after experimental infection with the Gardner-Arnstein strain of FeLV. Restriction fragments were ordered by single and double enzyme digests followed by Southern transfer (1) and hybridization with 32P-labeled viral cDNA probes. The restriction map was oriented with respect to the 5' and 3' ends of viral RNA by using a 3' specific hybridization probe. The major form of unintegrated viral DNA found was a 8.7 kb linear DNA molecule bearing a 450 bp direct long terminal redundancy (LTR) derived from both 5' and 3' viral RNA sequences. Minor, circular forms, 8.7 kb and 8.2 kb in length were also detected, the larger one probably containing two adjacent copies of the LTR and the smaller one containing one copy of the LTR. Integrated copies of FeLV are colinear with the unintegrated linear form and contain the KpnI and SmaI sites found in each LTR.", "doi": "10.1093/nar/8.15.3287", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1980-08-11", "series_number": "15", "volume": "8", "issue": "15", "pages": "3287-3305" }, { "id": "authors:03231-rfh60", "collection": "authors", "collection_id": "03231-rfh60", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:COHjvir80", "type": "article", "title": "Baboon endogenous virus genome. I. Restriction enzyme map of the unintegrated DNA genome of a primate retrovirus", "author": [ { "family_name": "Cohen", "given_name": "Maurice", "clpid": "Cohen-Maurice" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "McAllister", "given_name": "Robert M.", "clpid": "McAllister-R-M" }, { "family_name": "Shure", "given_name": "Mavis", "clpid": "Shure-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Rice", "given_name": "Nancy", "clpid": "Rice-N" }, { "family_name": "Gilden", "given_name": "Raymond V.", "clpid": "Gilden-R-V" } ], "abstract": "A detailed restriction map was deduced for the genome of an endogenous retrovirus of a higher primate, that of baboon. The cleavage sites for 12 restriction enzymes were mapped. The unintegrated linear viral DNA intermediate that is produced by infection of permissive cells with baboon endogenous virus was isolated. Hybridization with a strong-stop complementary DNA probe demonstrated presence of a terminal repetition in the linear viral DNA. The positions of restriction sites for two particular enzymes, SmaI and XhoI, near each end were consistent with this result and indicated that the length of the repetition is 0.55 +/- 0.01 kilobase. The linear viral DNA had a unique restriction map indicating that it is not a set of random circular permutations of the RNA genome. From hybridization with a 3'-specific probe, the DNA restriction map was aligned relative to the 5'-to-3' orientation of the viral RNA. We observed a minor heterogeneity in a BamHI recognition site 1.95 kilobases from the right end of the linear map.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1980-04", "series_number": "1", "volume": "34", "issue": "1", "pages": "28-39" }, { "id": "authors:j81jh-6rq65", "collection": "authors", "collection_id": "j81jh-6rq65", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:CHIjvir79b", "type": "article", "title": "Heteroduplex analysis of the RNA of clone 3 Moloney murine sarcoma virus", "author": [ { "family_name": "Chen", "given_name": "Yueh-Hsiu", "clpid": "Chien-Y-H" }, { "family_name": "Verma", "given_name": "Inder M.", "clpid": "Verma-I-M" }, { "family_name": "Duesberg", "given_name": "P. H.", "clpid": "Duesberg-P-H" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Heteroduplex analysis of the RNA isolated from purified virions of clone 3 Moloney murine sarcoma virus (M-MSV) hybridized to cDNA's from Moloney murine leukemia virus (M-MLV) and clone 124 M-MSV shows that the main physical component of clone 3 RNA is missing all or most of the 1.5-kilobase (kb) clone 124 M-MSV specific sequence denoted beta s (S. Hu et al. Cell 10:469-477, 1977). This sequence is either deleted in clone 3 RNA or substituted by a very short (0.3-kilobase) sequence. In other respects, clone 3 and clone 124 RNAs show the same heteroduplex structure relative to M-MLV. Since beta s is believed to contain the src gene(s) of clone 124 RNA, this result leaves as an unresolved question the nature of the src gene(s) of the clone 3 M-MSV RNA complex.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1979-12-01", "series_number": "3", "volume": "32", "issue": "3", "pages": "1028-1032" }, { "id": "authors:gynds-xa030", "collection": "authors", "collection_id": "gynds-xa030", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:MANjvir79", "type": "article", "title": "Electron microscopic mapping of RNA transcribed from the late region of polyoma virus DNA", "author": [ { "family_name": "Manor", "given_name": "Haim", "clpid": "Manor-H" }, { "family_name": "Wu", "given_name": "Madeline", "clpid": "Wu-M" }, { "family_name": "Baran", "given_name": "Nava", "clpid": "Baran-N" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The polyoma virus (Py) RNA species transcribed from the L DNA strand of the \"late\" region of the Py genome in Py-infected mouse cells have been mapped by hybridization with specific fragments of Py DNA followed by electron microscopic visualization of the hybrids. Total cellular polyadenylated Py-specific RNA molecules having an S value in the range of 16S to 20S were purified by oligodeoxythymidylic acidcellulose column chromatography, preparative hybridization with Py DNA, and sucrose gradient centrifugation. Cytoplasmic Py-specific RNA was similarily purified, except that it was not fractionated by sucrose gradient centrifugation. Hybrids of these RNA molecules and Py DNA fragments were spread for electron microscopy by either the cytochrome c technique or the bacteriophage T4 gene 32 protein method. The polyadenylic acid at the 3'-end of the RNA in the hybrids was identified by labeling with simian virus 40 DNA circles to which polybromodeoxyuridylic acid tails had been covalently attached. These experiments revealed the presence of three L DNA strand transcripts in both RNA preparations. Two of these RNA molecules were found to be spliced from chains transcribed from two noncontiguous parts of the late region. The third molecule either is a continuous transcript of the entire late region or contains a splicing feature which is too small to be reliably observed by the electron microscope methods used. The 5'-ends of the three RNA species map within a region extending from 68 to 70 map units on the Py restriction endonuclease map. Each of the two spliced molecules contains a 5'-terminal leader sequence transcribed from a DNA segment with an estimated length of 60 to 110 nuvleotides. The 3'-ends of the leaders map at 66.7 +/- 1.0 and 66.4 +/- 0.50 map units. In these molecules the 5'-ends of the other part (the main body) map at 59.4 +/- 0.90 and 49.4 +/- 2.0 map units, respectively. The 3'-termini of all three RNA species map at 24 to 25 map units.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1979-10-01", "series_number": "1", "volume": "32", "issue": "1", "pages": "293-303" }, { "id": "authors:rz125-ek371", "collection": "authors", "collection_id": "rz125-ek371", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:WUMjvir79", "type": "article", "title": "Secondary structures in polyoma DNA", "author": [ { "family_name": "Wu", "given_name": "Madeline", "clpid": "Wu-M" }, { "family_name": "Manor", "given_name": "Haim", "clpid": "Manor-H" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Three reproducible secondary-structure features were observed on single strands of polyoma virus DNA mounted for electron microscopy by the T4 gene 32 protein technique: (i) a hairpin fold-back extending from 92.9 +/- 0.8 to 95.0 +/- 0.7 map units; (ii) a small loop extending from 63.2 +/- 3.1 to 68.5 +/- 2.8 map units; and (iii) a big loop extending from 51.9 +/- 2.3 to 68.9 +/- 2.1 map units. Both loops are bounded by inverted repeat stems of length 40 +/- 20 base pairs. The stem sequences around 68.5 and 68.9 of the large and small loops overlap, either partially or completely. Several lines of evidence indicate that the inverted repeat stems of the two secondary-structure loops lie in the regions of polyoma virus DNA flanking and probably very close to the sequences that are spliced out in the formation of the late 16S and 18S messages, whereas the hairpin fold-back appears to map at a splicing point of an early message. These structures may therefore be important for the processing of the primary transcripts to form the early and late messages.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1979-10-01", "series_number": "1", "volume": "32", "issue": "1", "pages": "334-338" }, { "id": "authors:69rdz-16x67", "collection": "authors", "collection_id": "69rdz-16x67", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:CHIjvir79a", "type": "article", "title": "Heteroduplex Analysis of the Sequence Relationships Between the Genomes of Kirsten and Harvey Sarcoma Viruses, Their Respective Parental Murine Leukemia Viruses, and the Rat Endogenous 30S RNA", "author": [ { "family_name": "Chien", "given_name": "Yueh-Hsiu", "clpid": "Chien-Y-H" }, { "family_name": "Lai", "given_name": "Michael", "clpid": "Lai-M" }, { "family_name": "Shih", "given_name": "Thomas Y.", "clpid": "Shih-T-Y" }, { "family_name": "Verma", "given_name": "Inder M.", "clpid": "Verma-I-M" }, { "family_name": "Scolnick", "given_name": "Edward M.", "clpid": "Scolnick-E-M" }, { "family_name": "Roy-Burman", "given_name": "Pradip", "clpid": "Roy-Burman-P" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The sequence relations between Kirsten murine sarcoma virus (Ki-SV), Harvey murine sarcoma virus (Ha-SV), and a rat endogenous 30S RNA were studied by electron microscope heteroduplex analysis. The sequence relationships between the sarcoma viruses and their respective parental murine leukemia viruses (Kirsten and Moloney murine leukemia viruses), as well as between the two murine leukemia viruses, were also studied. The only observed nonhomology feature of the Kirsten murine leukemia virus/Moloney murine leukemia virus heteroduplexes was a substitution loop with two arms of equal length extending from 1.80 \u00b1 0.18 kilobases (kb) to 2.65 \u00b1 0.27 kb from the 3' end of the RNA. It is believed that this feature lies in the env gene region of the viral genomes. The Ha-SV and Moloney murine leukemia virus genomes (respective lengths, 6.0 and 9.0 kb) were homologous in a 1.0 \u00b1 0.05-kb region at the 3' end and possibly over a 200-nucleotide region at the 5' ends; otherwise, they were nonhomologous. Ha-SV and Ki-SV (length, 7.5 kb) were homologous in the first 4.36 \u00b1 0.37-kb region from the 3' end and in a 0.70 \u00b1 0.15-kb region at the 5' end. In between, there was a nonhomology region, possibly containing a short (0.23-kb) region of partial or total homology. The heteroduplex analysis between rat endogenous 30S RNA and Ki-SV shows that there are mixed regions of sequence homology and nonhomology at both the 5' and 3' ends. However, there is a large (4-kb) region of homology between Ki-SV and the rat 30S RNA in the center of the genomes, with only a small nonhomology hairpin feature. These studies help to define the regions of homology between the Ha-SV and Ki-SV genomes with each other and with the rat endogenous 30S RNA. These regions may be related to the sarcoma genicity of the viruses. In particular, the 0.7-kb region of homology of Ha-SV with Ki-SV at the 5' ends may be related to the formation of a 21,000-dalton phosphoprotein in cells transformed by either virus.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1979-09-01", "series_number": "3", "volume": "31", "issue": "3", "pages": "752-760" }, { "id": "authors:st6m4-gw139", "collection": "authors", "collection_id": "st6m4-gw139", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:WUMnar79", "type": "article", "title": "Electron microscopic mapping of proteins bound to herpes simplex virus DNA", "author": [ { "family_name": "Wu", "given_name": "Madeline", "clpid": "Wu-M" }, { "family_name": "Hyman", "given_name": "Richard W.", "clpid": "Hyman-R-W" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Exonuclease digestion experiments have suggested that there is a protein(s) bound close to one or both ends of herpes sir virus-1 (HSV) DNA. The existence of such bound proteins has been positiviely demonstrated and their positions on the HSV genolie determined by application of a newly developed method for electron microscopic mapping of proteins bound to nucleic acids. Purified HSV DNA was treated with dinitrofluorobenzene under conditions that covalently attach the dinitrophenyl (DNP) group to the proteins in protein-nucleic acid complex. The HSV DNA-protein-(DNP)n complex was treated with rabbit anti-DNP IgG, and, in some cases, additionally treated with monovalent Fab fragments of goat anti-rabbit IgG, and mounted for examination in the electron microscope. Electron opaque dots representing the protein-(DNP)n-(IgG)m complex were seen on the HSV DNA. Direct measurements of the positions of the protein, as well as partial denaturation mapping, indicate that there are four positions for protein bound to HSV DNA: two near but not at the two ends and two at sites corresponding to the internalinverted repeats of the ends. These results suggest that there is a specific protein binding sequence within the direct terminal repeat of HSV DNA. The previous obseroation t HSV DNA is more sensitive to digestion by a 3' than by a 5' exonuolease then indicates that the bound protein(s) is more intimately associated with one strand of the specific sequence than with the complementary strand.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1979-08-10", "series_number": "11", "volume": "6", "issue": "11", "pages": "3427-3441" }, { "id": "authors:68c6b-emt64", "collection": "authors", "collection_id": "68c6b-emt64", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:EARpnas79", "type": "article", "title": "Immunoglobulin heavy chain gene organization in mice: Analysis of a myeloma genomic clone containing variable and \u03b1 constant regions", "author": [ { "family_name": "Early", "given_name": "Philip W.", "clpid": "Early-P-W" }, { "family_name": "Davis", "given_name": "Mark M.", "clpid": "Davis-M-M" }, { "family_name": "Kaback", "given_name": "David B.", "clpid": "Kaback-D-B" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Hood", "given_name": "Leroy", "orcid": "0000-0001-7158-3678", "clpid": "Hood-L-E" } ], "abstract": "We have isolated a myeloma genomic DNA clone containing the variable and constant regions of a mouse chain. Restriction enzyme analyses and electron microscopic R loop mapping have demonstrated that the variable region is separated from the constant region by 6.8 kilobases of intervening DNA. In addition, two intervening DNA sequences of 100-200 bases separate the constant region into three approximately equal units. These intervening sequences may separate each of the segments coding for the three constant region domains of the heavy chain. Southern blot analysis of embryo and myeloma DNA suggests that DNA rearrangement of heavy chain variable and constant regions occurs during the differentiation of antibody-producing cells.", "doi": "10.1073/pnas.76.2.857", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1979-02-01", "series_number": "2", "volume": "76", "issue": "2", "pages": "857-861" }, { "id": "authors:44f0t-aja84", "collection": "authors", "collection_id": "44f0t-aja84", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:KABnar79", "type": "article", "title": "Improved methods for the formation and stabilization of R-loops", "author": [ { "family_name": "Kaback", "given_name": "David B.", "clpid": "Kaback-D-B" }, { "family_name": "Angerer", "given_name": "Lynne M.", "clpid": "Angerer-L-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Improved methods for the formation and stabilization of R-loops for visualization in the electron microscope are presented. The two complementary strands of a duplex DNA are photochemically crosslinked once every 1 to 3 kb using 4, 5', 8 trimethylpsoralen. R-loops are then formed by incubation with RNA in 70% formamide at a temperature above the DNA melting temperature. Finally, the R-loops are stabilized by modifying the free single strand of DNA with glyoxal, thus minimizing the displacement of the hybridized RNA by branch migration. In this manner R-loops can be formed and visualized at a high frequency irrespective of the base composition of the nucleic acid of interest.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1979-01-11", "series_number": "7", "volume": "6", "issue": "7", "pages": "2499-2517" }, { "id": "authors:brj39-yk283", "collection": "authors", "collection_id": "brj39-yk283", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:WUMnar78b", "type": "article", "title": "An electron microscope study of the proteins attached to polio virus RNA and its replicative form (RF)", "author": [ { "family_name": "Wu", "given_name": "Madeline", "clpid": "Wu-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Wimmer", "given_name": "Eckard", "clpid": "Wimmer-E" } ], "abstract": "A recently described method (Wu, M. and Davidson, N. (1978), Nucleic Acids Research 5, in press) for visualizing proteins attached to nucleic acids in the electron microscope has been applied to study proteins attached to poliovirion RNA and to the viral double-stranded intracellular RE form. A protein is found at the 5' end of the plus strand virion RNA, and protein components are found at both ends of the duplex RF. In the RF as usually extracted, there is frequently a larger or compound protein aggregate at the end which contains the 3' end of the plus strand and the 5' end of the minus strand. Banding in CsCl-guanidinium hydrochloride in the presence of sarkosyl causes dissociation of some components of this aggregate, leaving both ends labeled with the covalently bound VPg. These results confirm and extend previous biochemical studies of proteins bound to poliovirion RNA and to the RE form.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1978-12-01", "series_number": "12", "volume": "5", "issue": "12", "pages": "4711-4723" }, { "id": "authors:q1kwk-df661", "collection": "authors", "collection_id": "q1kwk-df661", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:CHIjvir78", "type": "article", "title": "Heteroduplex analysis of the sequence relations between the RNAs of mink cell focus-inducing and murine leukemia viruses", "author": [ { "family_name": "Chien", "given_name": "Yueh-Hsiu", "clpid": "Chien-Y-H" }, { "family_name": "Verma", "given_name": "Inder M.", "clpid": "Verma-I-M" }, { "family_name": "Shih", "given_name": "Thomas Y.", "clpid": "Shih-T-Y" }, { "family_name": "Scolnick", "given_name": "Edward M.", "clpid": "Scolnick-E-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The sequence relationships betwen AKR ecotropic virus and an AKR-derived \"mink cell focus-inducing\" (MCF) isolate (AKR MCF 247), between Moloney murine leukemia virus (M-MLV) and an M-MLV MCF isolate (M-MLV83), and between AKR and M-MLV were studied by electron microscopic heteroduplex analysis. The MCF-specific sequences were found to map from 1.95 kilobases (kb) to 2.75 kb (+/- 0.15 kb) from the 3' end of the RNAs for both MCF isolates. The major sequence nonhomology regions between AKR and M-MLV lie between 0.9 and 3.5 kb from the 3' end. However, the AKR and M-MLV sequences immediately adjacent to the 1.95- and 2.75-kb junctions with MCF-specific sequences are relatively similar in AKR and M-MLV. Our results suggest that the env gene of MLVs maps from 1 kb to 3 kb from the 3' end of the genomic RNA and that the carboxyl end of the glycoprotein of each MCF strain is similar (or identical) to that of its ecotropic parent.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1978-10-01", "series_number": "1", "volume": "28", "issue": "1", "pages": "352-360" }, { "id": "authors:jf1ze-wqr64", "collection": "authors", "collection_id": "jf1ze-wqr64", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:WUMnar78a", "type": "article", "title": "An electron microscopic method for the mapping of proteins attached to nucleic acids", "author": [ { "family_name": "Wu", "given_name": "Madeline", "clpid": "Wu-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "An electron microscopic method for demonstrating the presence of and mapping the positions of proteins specifically bound to nucleic acids is described. The nucleic acid-protein complex is treated with dinitro fluorobenzene under conditions such that dinitrophenyl (DNP) groups are attached to nucleophilic groups on the protein, with only a low level of random attachment to the nucleic acid. This product is treated with rabbit anti-DNP IgG. The position of the protein-(DNP)n(IgG)m complex on the nucleic acid strand can be observed by electron microscopy by protein free spreading methods and, in many cases, by cytochrome-c spread ing. If necessary for visualization by the latter method, the size of the labeled region can be increased by treatment with goat anti-rabbit IgG. High efficiency of electron microscopic labeling is achieved. Examples studied are: the adenovirus-2 DNA terminal protein, a protein covalently bound to 8V40 DNA, DNA polymerase I bound to DNA, E. coli RNA polymerase bound to T7 DNA and proteins UV cross linked to avian sarcoma virus RNA.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1978-08-01", "series_number": "8", "volume": "5", "issue": "8", "pages": "2825-2846" }, { "id": "authors:dpkr6-1qx69", "collection": "authors", "collection_id": "dpkr6-1qx69", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:CHInar78", "type": "article", "title": "RNA:DNA hybrids are more stable than DNA:DNA duplexes in concentrated perchlorate and trichloroacetate solutions", "author": [ { "family_name": "Chien", "given_name": "Yueh-Hsiu", "clpid": "Chien-Y-H" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Rates of formation of RNA:DNA hybrids have been measured as a function of temperature and compared to DNA:DNA duplex denaturation temperatures in 4 M sodium perchlorate, 4 M NaClO4-6 M urea, and 3 M rubidium trichioracetate solvents. The usual bell shaped curves of reaction rate versus temperature were observed. The optimal temperatures for the RNA:DNA association reaction are 5\u00b0 to 12\u00b0 greater than the Tm's for DNA:DNA denaturation in these solvents, just as in formamide. R-loops of \u03c680d3ilv DNA with E. coli rRNA can be formed at high efficiency in these solvents.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1978-05-01", "series_number": "5", "volume": "5", "issue": "5", "pages": "1627-1637" }, { "id": "authors:0asyg-jn761", "collection": "authors", "collection_id": "0asyg-jn761", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:BENjvir78", "type": "article", "title": "High-molecular-weight RNAs of AKR, NZB, and wild mouse viruses and avian reticuloendotheliosis virus all have similar dimer structures", "author": [ { "family_name": "Bender", "given_name": "Welcome", "clpid": "Bender-W" }, { "family_name": "Chien", "given_name": "Yueh-Hsiu", "clpid": "Chien-Y-H" }, { "family_name": "Chattopadhyay", "given_name": "Sisir", "clpid": "Chattopadhyay-S" }, { "family_name": "Vogt", "given_name": "Peter K.", "clpid": "Vogt-P-K" }, { "family_name": "Gardner", "given_name": "Murray B.", "clpid": "Gardner-M-B" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Several 50 to 70S tumor viral RNAs have previously been shown by electron microscopy to be dimers, with the two monomer subunits joined near their 5' ends. Five additional naturally occurring type C RNA tumor viruses have now been examined: AKR, and endogenous murine ecotropic virus; NZB, an endogenous murine xenotropic virus; and ecotropic and an amphotropic virus isolated from a wild mouse; and the avian reticuloendotheliosis virus (REV). All five 50 to 70S RNAs have similar 5'-to-5' dimer structures. Therefore, the observations support the hypothesis that the dimer linkage is a structural feature common to all type C mammalian viruses. REV is the first example of an avian virus with a clear 5'-to-5' dimer linkage. All of the mammalian viral RNAs, but not REV, showed symmetrically placed loops in each subunit of the dimer. Possible molecular structures and biological functions of the dimer linkages and loops are discussed.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1978-03-01", "series_number": "3", "volume": "25", "issue": "3", "pages": "888-896" }, { "id": "authors:hx2rn-1tj58", "collection": "authors", "collection_id": "hx2rn-1tj58", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:BROnar78", "type": "article", "title": "Electron microscopic visualization of tRNA genes with ferritin-avidin: biotin labels", "author": [ { "family_name": "Broker", "given_name": "Thomas R.", "clpid": "Broker-T-R" }, { "family_name": "Angerer", "given_name": "Lynne M.", "clpid": "Angerer-L-M" }, { "family_name": "Yen", "given_name": "Pauline H.", "clpid": "Yen-P-H" }, { "family_name": "Hershey", "given_name": "N. Davis", "clpid": "Hershey-N-D" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A method is described for indirect electron microscopic visualization and mapping of tRNA and other short transcripts hybridized to DNA. This method depends upon the attachment of the electron-dense protein ferritin to the RNA, the binding being mediated by the remarkably strong association of the egg white protein avidin with biotin. Biotin is covalently attached to the 3' end of tRNA using an NH2 (CH2) 5NH2 bridge. The tRNA-biotin adduct is hybridized to complementcrry DNA sequences present in a single stranded nonhomology loop of a DNA:DNA heteroduplex. Avidin, covalently crosslinked to ferritin is mixed with the heteroduplex and becomes bound to the hybridized tRNA-biotin. Observation of the DNA:RNA-biotin:avidin-ferritin complex by electron microsdopy specifically and accurately reveals the position of the tRNA gene, with a frequency of labeling of approximately 50%.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1978-02-01", "series_number": "2", "volume": "5", "issue": "2", "pages": "363-384" }, { "id": "authors:jxd8z-en868", "collection": "authors", "collection_id": "jxd8z-en868", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:SODnar78", "type": "article", "title": "Gene mapping and gene enrichment by the avidin-biotin interaction: use of cytochrome-c as a polyamine bridge", "author": [ { "family_name": "Sodja", "given_name": "Ann", "clpid": "Sodja-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A modification of previously described methods of electron microscopic gene mapping and of gene enrichment based on the avidin-biotin interaction is presented. The modification consists of coupling cytochrome-c instead of pentane tane diamine to the oxidized 2', 3' terminus of an RNA by Schiff base formation and reduction. The RNA-cytochrome-c conjugate is purified by a simple chromatographic procedure; several biotins are attached to the cytochrome moiety by acylation. The extended arm between biotin and RNA gives efficient electron microscopic gene mapping of DNA:RNA-biotin hybrids with avidin-ferritin and avidin-polymethacylate sphere labels and efficient gene enrichment by buoyant banding of DNA:RNA-biotin:avidin-spheres in CsCl. A 1400 fold enrichment (thus, 25% pure) and a 90% yield of long Drosophila DNA strands with 5S RNA genes is achieved.", "issn": "0305-1048", "publisher": "Nucleic Acids Research", "publication": "Nucleic Acids Research", "publication_date": "1978-02-01", "series_number": "2", "volume": "5", "issue": "2", "pages": "385-401" }, { "id": "authors:2m75f-s3k80", "collection": "authors", "collection_id": "2m75f-s3k80", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:MAIjvir78", "type": "article", "title": "Structure of 50 to 70S RNA from Moloney sarcoma viruses", "author": [ { "family_name": "Maisel", "given_name": "Jan", "clpid": "Maisel-J" }, { "family_name": "Bender", "given_name": "Welcome", "clpid": "Bender-W" }, { "family_name": "Hu", "given_name": "Sylvia", "clpid": "Hu-Sylvia" }, { "family_name": "Duesberg", "given_name": "P. H.", "clpid": "Duesberg-P-H" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The 50 to 70S RNAs of two clonal isolates of defective Moloney sarcoma-leukemia helper virus complex were analyzed by gel electrophoresis and electron microscopy. The RNAs extracted from both clone 3 and clone 124-5R of Moloney sarcoma-leukemia virus complex contained some large monomer subunits ca. 10,000 nucleotides in length (10 kilobases), which are believed to be the Moloney leukemia virus subunits. Both RNAs had an excess of a smaller, sarcoma-specific subunit, 5 kilobases (clone 3) or 6 kilobases (clone 124-5R) in length. Electron microscopy of intact 50 to 70S dimer RNA molecules showed for both clones many dimers of two small subunits, some dimers of two large subunits, but few if any heterodimers with one large and one small subunit. This result was unexpected because the sequences near the 5'end of the RNA subunits, which are believed to be involved in the dimer linkage, are probably homologous between the large and small subunits. We also observed that some small-small dimers migrated anomalously slowly on nondenaturing gels. The nature of this slow-migrating complex is unkown; it could be a higher aggregate of the small-small dimer with additional small or large subunits, or it could be an extended conformation of the small-small dimer.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1978-01", "series_number": "1", "volume": "25", "issue": "1", "pages": "384-394" }, { "id": "authors:sscxj-8mj65", "collection": "authors", "collection_id": "sscxj-8mj65", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:GUYjbact77", "type": "article", "title": "Heteroduplex analysis of tra delta f' plasmids and the mechanism of their formation", "author": [ { "family_name": "Guyer", "given_name": "Mark S.", "clpid": "Guyer-M-S" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Clark", "given_name": "Alvin J.", "clpid": "Clark-A-J" } ], "abstract": "Four tra delta FargG+ plasmids, derived from matings between Hfr AB312 and a recA recipient, have been shown to have deletions of at least 50% of the F genome, including the region in which the tra genes map. The mutant plasmids do contain the F genes required for plasmid maintenance. Correlations can be made between, on the one hand, the F genes present on the tradelta F' plasmids and the F genes transferred early by an Hfr donor, and, on the other hand, the F genes deleted from the tradelta F' plasmids and the F genes transferred late by an Hfr donor. A biased representation of proximally and distally transferred chromosomal markers among the tradelta F' elements was also demonstrated. Taken Taken together, the asymmetrical representation of Hfr genes and the cis dominance of the Tra phenotype of these mutants can best be explained by the hypothesis that the tradelta F' plasmids are formed by repliconation of the transferred exogenote in a recA recipient.", "issn": "0021-9193", "publisher": "Journal of Bacteriology", "publication": "Journal of Bacteriology", "publication_date": "1977-09-01", "series_number": "3", "volume": "131", "issue": "3", "pages": "970-980" }, { "id": "authors:15ebh-rh352", "collection": "authors", "collection_id": "15ebh-rh352", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HUSjvir77", "type": "article", "title": "Heteroduplex study of the sequence relations between RD-114 and baboon viral RNAs", "author": [ { "family_name": "Hu", "given_name": "Sylvia", "clpid": "Hu-Sylvia" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "McAllister", "given_name": "Robert M.", "clpid": "McAllister-R-M" } ], "abstract": "The regions of sequence homology and nonhomology between the RNA genomes of RD-114 and baboon endogenous type C viruses have been mapped by an electron microscope heteroduplex study. Short complementary DNA (cDNA) copies (approximately 150 to 200 nucleotides in length) of RD-114 RNA were prepared by an endogenous synthesis; labels of polydeoxythymidylic acid [poly(dT)] were attached to the 3' ends of the cDNA molecules by a reaction catalyzed by deoxynucleotidyl terminal transferase. The cDNA-poly(dT) was hybridized to RD-114 RNA and to baboon viral RNA dimer (50 to 70S) units, and the position- of the poly(dT) labels were observed by electron microscopy. With RD-114, labels were distributed uniformly along the genome. With baboon virus RNA (monomer length, 9.5 kilobases [kb]), the regions of high homology with RD-114 cDNA were observed to lie in the intervals from 1.5 to 2.5 kb and from 3.7 to 5.5 kb from the 5' end. The relations of these heteroduplex maps to the known antigenic similarities and differences among the several viral proteins and to the genetic maps of the viruses are discussed.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1977-08", "series_number": "2", "volume": "23", "issue": "2", "pages": "345-352" }, { "id": "authors:crvs0-mhy46", "collection": "authors", "collection_id": "crvs0-mhy46", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:CASnar77", "type": "article", "title": "Rates of formation and thermal stabilities of RNA:DNA and DNA:DNA duplexes at high concentrations of formamide", "author": [ { "family_name": "Casey", "given_name": "James", "clpid": "Casey-J-W" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The thermal stabilities of RNA:DNA hybrids are substantially greater than those of DNA:DNA duplexes in aqueous electrolyte solutions containing high concentrations of formamide. Association rates to form DNA:DNA duplexes and DNA:RNA hybrids have been measured in these solvents. There is a temperature range in which DNA:DNA rates are negligible and RNA:DNA rates close to optimal.", "doi": "10.1093/nar/4.5.1539", "pmcid": "PMC343772", "issn": "0305-1048", "publisher": "Oxford University Press", "publication": "Nucleic Acids Research", "publication_date": "1977-06", "series_number": "5", "volume": "4", "issue": "5", "pages": "1539-1552" }, { "id": "authors:xa55z-rgx48", "collection": "authors", "collection_id": "xa55z-rgx48", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:WUMjvir77", "type": "article", "title": "Structure of the inverted terminal repetition of adenovirus type 2 DNA", "author": [ { "family_name": "Wu", "given_name": "Madeline", "clpid": "Wu-M" }, { "family_name": "Roberts", "given_name": "Richard J.", "clpid": "Roberts-R-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Several secondary structure features involving the ends of single strands of adenovirus type 2 DNA have been studied by electron microscopy by both the gene 32-ethidium bromide technique and a modification of the standard formamide-cytochrome c technique. A duplex stem of length 115 +/- 10 nucleotide pairs due to pairing between the two members of the inverted terminal repetition is observed in the single-stranded circles that form upon annealing single-stranded linear molecules. This duplex stem is shown to lie at the ends of the DNA by using several reference markers: (i) a newly discovered secondary structure feature (a loop of length ca. 500 nucleotides with a 20-nucleotide pair duplex stem) that maps 73% of the full length from the left end of the molecule and (ii) a duplex region due to a hybridized restriction fragment. There is also some secondary structure within each end of linear single strands. There is some variation in the morphology of the end strucures, and we propose that these involve base pairing, as in a tRNA clover leaf, rather than an exact single hairpin-type inverted repeat. These observations are consistent with the hypothesis that there is a foldback structure at the 3' ends of the DNA that functions as a primer for the initiation of replication.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1977-02-01", "series_number": "2", "volume": "21", "issue": "2", "pages": "766-777" }, { "id": "authors:zrv64-r7081", "collection": "authors", "collection_id": "zrv64-r7081", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:JUNpnas77", "type": "article", "title": "Heteroduplex Analysis of Avian RNA Tumor Viruses", "author": [ { "family_name": "Junghans", "given_name": "R. P.", "clpid": "Junghans-R-P" }, { "family_name": "Hu", "given_name": "S.", "clpid": "Hu-S" }, { "family_name": "Knight", "given_name": "C. A.", "clpid": "Knight-C-A" }, { "family_name": "Davidson", "given_name": "N.", "clpid": "Davidson-N-R" } ], "abstract": "Electron microscopic heteroduplex analysis of avian RNA tumor viruses has been undertaken by using 35S viral RNA and long, complementary DNA synthesized in vitro. In this initial study, heteroduplex molecules were formed between complementary DNA from Rous sarcoma virus [Prague B strain (Pr-B)] and RNAs from Pr-B and Rous sarcoma virus [Prague C strain (Pr-C)] and from their transformation defective (td) derivatives, td-Pr-B and td-Pr-C. In the case of heteroduplexes with the td viruses, a deletion loop was observed of the order of two kilobases in size and less than one kilobase from the 3' terminus of the RNA. This deletion probably spans part or all of the sequences of one or more genes in the nondefective sarcoma virus which are essential for cell transformation. The sizes and the positions of the deletions in the td-Pr-B and td-Pr-C viruses were slightly, but significantly, different. No nonhomology features were observed in the Pr-B\u00b7 Pr-C hybrids, thus confirming the close genetic relatedness of the two viruses. All heteroduplexes contained a proportion of circular and dimer molecules. This observation is a direct demonstration that (-) strand DNA transcription begins at an internal position of the RNA genome, proceeds to the 5' end, reinitiates at the 3' end of the RNA, and copies the remainder of the viral genome. Other implications for models of RNA tumor virus replication are also developed from these data.", "doi": "10.1073/pnas.74.2.477", "pmcid": "PMC392312", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1977-02", "series_number": "2", "volume": "74", "issue": "2", "pages": "477-481" }, { "id": "authors:mscy7-7hs08", "collection": "authors", "collection_id": "mscy7-7hs08", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:DUBjvir76", "type": "article", "title": "Size, subunit composition, and secondary structure of the Friend virus genome", "author": [ { "family_name": "Dube", "given_name": "Shyam", "clpid": "Dube-S-K" }, { "family_name": "Kung", "given_name": "Hsing-Jien", "clpid": "Kung-H-J" }, { "family_name": "Bender", "given_name": "Welcome", "clpid": "Bender-W" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Ostertag", "given_name": "Wolfram", "clpid": "Ostertag-W" } ], "abstract": "Electron microscope and gel electrophoresis studies show that the high-molecular-weight (50 to 70S) RNA extract from Friend virus (FV) is a dimer with the same basic structure previously observed for the RNAs from RD-114 virus, baboon virus, and woolly monkey virus. This observation greatly strengthens the inference that the dimer structure is a general characteristic of the RNAs of all mammalian type C viruses. The FV dimer is slightly less stable than the RNA dimer of woolly monkey virus, which is, in turn, much less stable than those of RD-114 and baboon virus. There are three FV monomer components, small (S), medium (M), and large (L), with molecular lengths of 6.7 +/- 0.6, 7.7 +/- 0.6, and 9.5 +/- 0.6 kilobases, respectively. There are approximately equal amounts of the S and M components and much less of the L component. Most of the dimers are homodimers (SS, MM, and LL). The frequency of heterodimers (SM, SL, ML) is much less than expected for a random assortment model.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1976-10-01", "series_number": "1", "volume": "20", "issue": "1", "pages": "264-272" }, { "id": "authors:f4a9c-ry377", "collection": "authors", "collection_id": "f4a9c-ry377", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:SKUjbact76", "type": "article", "title": "Replication region fragments cloned from Flac+ are identical to EcoRI fragment f5 of F", "author": [ { "family_name": "Skurray", "given_name": "Ronald A.", "clpid": "Skurray-R-A" }, { "family_name": "Guyer", "given_name": "Mark S.", "clpid": "Guyer-M-S" }, { "family_name": "Timmis", "given_name": "Kenneth", "clpid": "Timmis-K" }, { "family_name": "Cabello", "given_name": "Felipe", "clpid": "Cabello-F" }, { "family_name": "Cohen", "given_name": "Stanley N.", "clpid": "Cohen-S-N" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Clark", "given_name": "Alvin J.", "clpid": "Clark-A-J" } ], "abstract": "The replication region fragments from Flac+ cloned in plasmids pSC138 and pML31 are identical with each other and with EcoRI fragment 5 of plasmid F.", "issn": "0021-9193", "publisher": "Journal of Bacteriology", "publication": "Journal of Bacteriology", "publication_date": "1976-09-01", "series_number": "3", "volume": "127", "issue": "3", "pages": "1571-1575" }, { "id": "authors:12eq0-je484", "collection": "authors", "collection_id": "12eq0-je484", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:GUYjbact76", "type": "article", "title": "Electron microscope study of a plasmid chimera containing the replication region of the Escherichia coli F plasmid", "author": [ { "family_name": "Guyer", "given_name": "Mark S.", "clpid": "Guyer-M-S" }, { "family_name": "Figurski", "given_name": "David", "clpid": "Figurski-D" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "pML31, a plasmid chimera constructed to contain the replication genes of an Flac plasmid, has been studied by electron microscope methods. Heteroduplex analysis shows that the only F sequence present in pML31 is that with corrdinates 40.3-49.3F. This region has previously been identified as essential for plasmid maintenance. The sequence of pML31, which was derived originally from R6-5, carries the km gene(s) and an inverted duplication of a 1.0-kilobase sequence. On the basis of length measurements, the repeated sequence is different from IS1, IS2, IS3, and an inverted repeat associated with the km gene(s) of plasmid JR67.", "issn": "0021-9193", "publisher": "Journal of Bacteriology", "publication": "Journal of Bacteriology", "publication_date": "1976-08-01", "series_number": "2", "volume": "127", "issue": "2", "pages": "988-997" }, { "id": "authors:wybxz-k7f34", "collection": "authors", "collection_id": "wybxz-k7f34", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:WUMpnas75", "type": "article", "title": "Use of gene 32 protein staining of single-strand polynucleotides for gene mapping by electron microscopy: Application to the phi-80d3ilvsu+7 system", "author": [ { "family_name": "Wu", "given_name": "Madeline", "clpid": "Wu-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A method for visualizing RNA\u00b7DNA duplex regions along a single strand of DNA in the electron microscope is described. A preparation of RNA molecules is hybridized to a long DNA strand containing the coding sequences (genes) for some of the RNAs. T4 gene 32 protein, which binds selectively and cooperatively only to the single-strand regions, is added, followed by glutaraldehyde. The resulting nucleic acid-gene 32 complex is adsorbed to the surface of an electron microscope grid in the presence of ethidium bromide. The single-strand regions are relatively thick (8.5 nm) compared to the duplex (RNA\u00b7DNA hybrid) regions (3.5 nm), so that the two kinds of regions are readily recognized by electron microscopy. In favorable cases, tRNA\u00b7DNA hybrids of length about 80 nucleotide pairs can be recognized (although with difficulty). The positions of a number of interesting genetic sequences on the DNA of the transducing phage phi80d3ilvsu+7 have been mapped. The r strand contains 16S, 23S, and 5S rRNA coding sequences in that order. The spacer between 16S and 23S genes has a length of 500 nucleotides and contains the coding sequence for a tRNA2{}Glu gene in agreement with previous biochemical observations. The spacer between the 23S and 5S genes has a length of 180 nucleotides. The su+7 tRNATrp coding sequence has been mapped on the l strand at a position just to the left of the ilv genes. Secondary structure loops due to short inverted repeat sequences flanking the 16S, 23S, tRNATrp, and F sequences in the DNA have been observed.", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1975-11-01", "series_number": "11", "volume": "72", "issue": "11", "pages": "4506-4510" }, { "id": "authors:9tdtb-xhj80", "collection": "authors", "collection_id": "9tdtb-xhj80", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:KUNjvir75", "type": "article", "title": "Structure, subunit composition, and molecular weight of RD-114 RNA", "author": [ { "family_name": "Kung", "given_name": "Hsing-Jien", "clpid": "Kung-H-J" }, { "family_name": "Bailey", "given_name": "James M.", "clpid": "Bailey-J-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "McAllister", "given_name": "Robert M.", "clpid": "McAllister-R-M" } ], "abstract": "The properties and subunit composition of the RNA extracted from RD-114 virions have been studied. The RNA extracted from the virion has a sedimentation coefficient of 52S in a nondenaturing aqueous electrolyte. The estimated molecular weight by sedimentation in nondenaturing and weakly denaturing media is in the range 5.7 X 10^(6) to 7.0 X 10^(6). By electron microscopy, under moderately denaturing conditions, the 52S molecule is seen to be an extended single strand with a contour length of about 4.0 \u00b5m corresponding to a molecular weight of 5.74 X 10^(6). It contains two characteristic secondary structure features: (i) a central Y- or T-shaped structure (the rabbit ears) with a molecular weight of 0.3 X 10^(6), (ii) two symmetreically disposed loops on each side of and at equal distance from the center. The 52S molecule consists of two half-size molecules, with molecular weight 2.8 X 10^(6), joined together within the central rabbit ears feature. Melting of the rabbit ears with concomitant dissociation of the 52S molecule into subunits, has been caused by either one of two strongly denaturing treatments: incubation in a mixture of CH3HgOH and glyoxal at room temperature, or thermal dissociation in a urea-formamide solvent. When half-size molecules are quenched from denaturing temperatures, a new off-center secondary structure feature termed the branch-like structure is seen. The dissociation behavior of the 52S complex and the molecular weight of the subunits have been confirmed by gel electrophoresis studies. The loop structures melt at fairly low temperatures; the dissociation of the 52S molecule into its two subunits occurs at a higher temperature corresponding to a base composition of about 63% guanosine plus cytosine. Polyadenylic acid mapping by electron microscopy shows that the 52S molecule contains two polyadenylic acid segments, one at each end. It thus appears that 52S RD-114 RNA consists of two 2.8 X 10^(6) dalton subunits, each with a characteristic secondary structure loop, and joined at the 5' ends to form the rabbit ears secondary structure feature. The observations are consistent with but do not require the conclusion that the two 2.8 X 10^(6) dalton subunits of 52S RD-114 RNA are identical.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1975-08-01", "series_number": "2", "volume": "16", "issue": "2", "pages": "397-411" }, { "id": "authors:6qqmb-kve51", "collection": "authors", "collection_id": "6qqmb-kve51", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HUSjbact75c", "type": "article", "title": "alphabeta sequence of F is IS31", "author": [ { "family_name": "Hu", "given_name": "Sylvia", "clpid": "Hu-Sylvia" }, { "family_name": "Ptashne", "given_name": "Kay", "clpid": "Ptashne-K" }, { "family_name": "Cohen", "given_name": "Stanley N.", "clpid": "Cohen-S-N" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Previous studies have shown that there is a deoxyribonucleic acid (DNA) segment, of length 1.3 kb and denoted as the alphabeta sequence, which occurs twice on the F plasmid at corrdinates 93.2 to 94.5/OF kb and 13.7 to 15.0F kb. In the present investigation, heteroduplexes were prepared between a phage DNA carrying the insertion sequence IS3 and suitable F-prime DNAs. The hybrids formed show that IS3 is the same as alphabeta. This result plus previous studies support the view that: (i) the insertion sequence IS2 and IS3 occur on F and, in multiple copies, on the main bacterial chromosome of Escherichia coli K-12; and (ii)these IS sequences on the main bacterial chromosomes are hot spots for Hfr formation by reciprocal recombination with the corresponding sequences of F.", "issn": "0021-9193", "publisher": "Journal of Bacteriology", "publication": "Journal of Bacteriology", "publication_date": "1975-08", "series_number": "2", "volume": "123", "issue": "2", "pages": "687-692" }, { "id": "authors:cnc1t-gw898", "collection": "authors", "collection_id": "cnc1t-gw898", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20201020-103534448", "type": "article", "title": "A new method of in situ hybridization", "author": [ { "family_name": "Manning", "given_name": "Jerry E.", "clpid": "Manning-J-E" }, { "family_name": "Hershey", "given_name": "N. Davis", "clpid": "Hershey-N-D" }, { "family_name": "Broker", "given_name": "Thomas R.", "clpid": "Broker-T-R" }, { "family_name": "Pellegrini", "given_name": "Maria", "clpid": "Pellegrini-M" }, { "family_name": "Mitchell", "given_name": "Herschel K.", "clpid": "Mitchell-H-K" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A new method for gene mapping at the chromosome level using in situ hybridization and scanning electron microscopy is described and has been applied to mapping the rRNA genes of Drosophila melanogaster. Biotin is covalently attached to Drosophila rRNA via a cytochrome c bridge at a ratio of one cytochrome-biotin per 130 nucleotides by a chemical procedure. Polymethacrylate spheres with a diameter of ca. 60 nm are prepared by emulsion polymerization and are covalently attached to the protein avidin at a ratio of 5\u201320 avidins per sphere. The biotin-labeled rRNA is hybridized to denatured DNA in a chromosome squash. Upon incubation with a sphere solution, some of the biotin sites become labeled with spheres because of the strong non-covalent interaction between biotin and avidin. The chromosome squash is examined in the scanning electron microscope (SEM). Polymer spheres, which are visible in the SEM, are observed to label the nucleolus, where the rRNA genes are located.", "doi": "10.1007/bf00333039", "issn": "0009-5915", "publisher": "Springer", "publication": "Chromosoma", "publication_date": "1975-06", "series_number": "2", "volume": "53", "issue": "2", "pages": "107-117" }, { "id": "authors:rzsce-nct87", "collection": "authors", "collection_id": "rzsce-nct87", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HUSjbact75a", "type": "article", "title": "Electron microscopic heteroduplex studies of sequence relations among plasmids of Escherichia coli: structure of F13 and related F-primes", "author": [ { "family_name": "Hu", "given_name": "Sylvia", "clpid": "Hu-Sylvia" }, { "family_name": "Ohtsubo", "given_name": "Eiichi", "clpid": "Ohtsubo-E" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "The structure of F13, a plasmid containing lac, purE, and proC, has been determined by heteroduplex analysis. As expected for an F-prime formed by a type II excision event, it contains all the sequences of F plus a large segment of Escherichia coli chromosomal deoxyribonucleic acid. There is a sequence of F with coordinates 16.3-17.6F which has been shown in other studies to be the insertion sequence IS2. This IS2 occurs twice on F13, once at each of the two junctions of F deoxyribonucleic acid with chromosomal deoxyribonucleic acid. The sequence alpha beta which occurs twice on F with coordinates 93.2-94.5/OF and 13.7-15.0F occurs an additional three times, twice in an inverted order relative to the alpha beta sequences of F, on the chromosomal sequences of F13. The structures of the plasmids F13-4 and F210 have been determined. The common sequences of F13 with F152-1 (a derivative of F152, the classical F2gal) and with F13-4 and F210 have been mapped. These results partially map lac, proC, tsx, and purE on F13. On the basis of all of these results, it is proposed that Hfr 13 (the parent of F13) was formed by recirpocal recombination between IS2 on F and an IS2 resident at a point between lac and proC on the chromosome of the F+ parent of Hfr 13. It is proposed that this IS2 and the several alpha beta sequences on the chromosomal part of F13 are hot spots for recombination with F, i.e., for Hfr formation. The point of origin and direction of transfer of many Hfr's can be explained by this hypothesis. In particular, the sequence relations of F42-1 (Flac) and of F152-1 (F 2gal) with F13 are completely consistent with this model.", "issn": "0021-9193", "publisher": "Journal of Bacteriology", "publication": "Journal of Bacteriology", "publication_date": "1975-05", "series_number": "2", "volume": "122", "issue": "2", "pages": "749-763" }, { "id": "authors:8hcm8-jzz16", "collection": "authors", "collection_id": "8hcm8-jzz16", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HUSjbact75b", "type": "article", "title": "Electron microscope heteroduplex studies of sequence relations among bacterial plasmids: identification and mapping of the insertion sequences IS1 and IS2 in F and R plasmids", "author": [ { "family_name": "Hu", "given_name": "Sylvia", "clpid": "Hu-Sylvia" }, { "family_name": "Ohtsubo", "given_name": "Eiichi", "clpid": "Ohtsubo-E" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Saedler", "given_name": "Heinz", "clpid": "Saedler-H" } ], "abstract": "Heteroduplex experiments between the plasmid R6 and one strand of the deoxyribonucleic acid (DNA) of a lambda phage carrying the insertion sequence IS1 show that IS1 occurs on R6 at the two previously mapped junctions of resistance transfer factor (RTF) DNA with R-determinant DNA. From previous heteroduplex experiments, it then follows that IS1 occurs at the same junctions in R6-5, R100-1, and R1 plasmids. Heteroduplex experiments with the DNA from a lambda phage carrying the insertion sequence IS2 show that one copy of IS2 occurs in R6, R6-5, and R100-1 (but not R1) at a point within the RTF with coordinates 67.5 TO 68.9 kilobase units (kb). In an accompanying paper, Ptashne and Cohen (1975) show that the insertion sequence IS3 occurs on R6 and R6-5. R100-25, a traC mutant, differs from its parent R100-1 only in that it contains an additional copy of IS1 inserted within the tra gene region of 82.1 kb. R100-31, atraX, TC-s mutant of R100-1, is deleted in R100-1 sequences starting at one of the IS3 termini (46.9 kb) and extending with RTF to 61.0 kb. Heteroduplex studies of F plasmids with the DNA of a lambda phage bearing insertion sequence IS2 show that the sequence of F with coordinates 16.3-17.6F is IS2. The occurrence of IS1 at the two junctions of R-determinant DNA and RTF DNA in R plasmids provides a structural basis to explain the mechanism of the previously observed formation of molecules containing one RTF unit and several tandem copies of the R-determinant unit, when R plasmids in Proteus mirabilis are grown in the presence of antibiotics, and the segregation of an R plasmid into an RTF unit and an R-determinant unit. In general, correlation of our results with previous studies shows that insertion sequences play a role in a variety of F- and R-related intra- and intermolecular recombination phenomena.", "issn": "0021-9193", "publisher": "Journal of Bacteriology", "publication": "Journal of Bacteriology", "publication_date": "1975-05", "series_number": "2", "volume": "122", "issue": "2", "pages": "764-775" }, { "id": "authors:rgwyf-09d05", "collection": "authors", "collection_id": "rgwyf-09d05", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:KUNjvir74", "type": "article", "title": "Structure and Molecular Length of the Large Subunits of RD-114 Viral RNA", "author": [ { "family_name": "Kung", "given_name": "Hsing-Jien", "clpid": "Kung-H-J" }, { "family_name": "Bailey", "given_name": "James M.", "clpid": "Bailey-J-M" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Nicolson", "given_name": "Margery O.", "clpid": "Nicolson-M-O" }, { "family_name": "McAllister", "given_name": "Robert M.", "clpid": "McAllister-R-M" } ], "abstract": "By electron microscopy, the large subunits of RD-114 RNA have a molecular weight of 5.0 x 10^6; they all have a characteristic secondary structure feature close to the middle.", "issn": "0022-538X", "publisher": "Journal of Virology", "publication": "Journal of Virology", "publication_date": "1974-07-01", "series_number": "1", "volume": "14", "issue": "1", "pages": "170-173" }, { "id": "authors:a0k61-hgv94", "collection": "authors", "collection_id": "a0k61-hgv94", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:HSUpnas72", "type": "article", "title": "Structure of inserted bacteriophage Mu-1 DNA and physical mapping of bacterial genes by Mu-1 DNA insertion", "author": [ { "family_name": "Hsu", "given_name": "Ming-Ta", "clpid": "Hsu-M-T" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "It is shown, by electron microscope observation of the structures of heteroduplexes, that Mu-1 DNA inserted into the bacterial episomes Flac and F8[1] is collinear with, rather than a circulation permutation of, the DNA of the mature Mu-1 bacteriophage. Observation of the position of the inserted Mu defines a point within the gene that has been inactivated (the lacI gene for Flac and a transfer gene in F8[1] in these particular instances). These examples illustrate a new, general method for physical gene mapping. The episome with Mu DNA inserted into F8[1] [i.e., F8[1](Mu)], although derived from a single colony, is heterogeneous in that a self-renatured sample shows a nonhomology loop of length 3.0 kb. This nonhomology loop, which has previously been observed in mature Mu-1 DNA, is due to an inversion.", "doi": "10.1073/pnas.69.10.2823", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1972-10-01", "series_number": "10", "volume": "69", "issue": "10", "pages": "2823-2827" }, { "id": "authors:tnmnr-knv75", "collection": "authors", "collection_id": "tnmnr-knv75", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:KIMpnas72", "type": "article", "title": "Electron Microscope Studies of Heteroduplex DNA from a Deletion Mutant of Bacteriophage phi X-174", "author": [ { "family_name": "Kim", "given_name": "Jung-Suh", "clpid": "Kim-J-S" }, { "family_name": "Sharp", "given_name": "Phillip A.", "clpid": "Sharp-P-A" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "A population of double-stranded replicative form of DNA molecules from bacteriophage phi X-174 carrying a deletion of about 9% of the wild-type DNA has been discovered in a sample cultivated under conditions where the phage lysozyme gene is nonessential. The structures of deleted monomers, dimers, and trimers were studied by the electron microscope heteroduplex method. The dimers and trimers are head-to-tail repeats of the deleted monomers. Some interesting examples of the dynamical phenomenon of branch migration in vitro have been observed in heteroduplexes of deleted dimer and trimer strands with undeleted monomer viral strands from the wild-type phage.", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1972-07-01", "series_number": "7", "volume": "69", "issue": "7", "pages": "1948-1952" }, { "id": "authors:v718w-fzz51", "collection": "authors", "collection_id": "v718w-fzz51", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:DAVpnas68a", "type": "article", "title": "Electron-microscopic visualization of deletion mutations", "author": [ { "family_name": "Davis", "given_name": "Ronald W.", "clpid": "Davis-R-W" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" } ], "abstract": "Deletion mutants of \u03bb coliphage were discovered by Kellenberger, Zichichi, and Weigle.(1) The deletions can be mapped by genetic recombination experiments. It is not known if the recombination maps thus obtained give the true physical position of the deletions. The present paper describes a method for mapping deletion mutations with the electron microscope, thus obtaining the physical position of the deletion.", "doi": "10.1073/pnas.60.1.243", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1968-05-01", "series_number": "1", "volume": "60", "issue": "1", "pages": "243-250" }, { "id": "authors:tjrj7-3as82", "collection": "authors", "collection_id": "tjrj7-3as82", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20120816-144654347", "type": "article", "title": "The Buoyant Behavior of Viral and Bacterial DNA in Alkaline CsCl", "author": [ { "family_name": "Vinograd", "given_name": "Jerome", "clpid": "Vinograd-J" }, { "family_name": "Morris", "given_name": "Janet", "clpid": "Morris-J" }, { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Dove", "given_name": "William F., Jr.", "clpid": "Dove-W-F-Jr" } ], "abstract": "In equilibrium density gradient centrifugation, the banding polymer species is electrically neutral. The banding species for a negative polyelectrolyte with a polyanion\nP_(n)^(-z)n (where n is the degree of polymerization, and z the titration charge per monomer unit) in a CsCl salt gradient is CS_(zn)P_n. If the ion P_(n)^(-z)n is itself a weak acid, it may be titrated to the state P_(n)^(-(Zn+y)) by CsOH; the banding species is then Cs_(zn+y)P_n. Because of the large mass and high effective \"density\" of a Cs^+ ion, it is to be expected that the buoyant density in a CsCl gradient of a polymer acid will be increased by such a partial alkaline titration with CsOH. This expectation has been confirmed for polyglutamic acid (where z = 0 at low pH). The guanine and thymine monomer units of DNA are weak acids. The present communication is concerned with the increase in buoyant density of DNA in alkaline CsCl solutions. It is well known that the guanine and thymine protons are more readily titrated in denatured DNA than in native DNA. We find that the buoyant density of denatured DNA and of single strand \u03d5X-174 DNA gradually increases as the pH of the solution is increased beyond pH 9.8. The density of native DNA is not affected until a critical pH > 11 is reached, where the DNA abruptly denatures and increases in density. Similar increases in buoyant density have been observed independently by Baldwin and Shooter in their studies of 5BU[overbar]-substituted DNA's in alkaline solutions.", "doi": "10.1073/pnas.49.1.12", "issn": "0027-8424", "publisher": "National Academy of Sciences", "publication": "Proceedings of the National Academy of Sciences of the United States of America", "publication_date": "1963-01-01", "series_number": "1", "volume": "49", "issue": "1", "pages": "12-17" }, { "id": "authors:4tfg0-xwa33", "collection": "authors", "collection_id": "4tfg0-xwa33", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:20131216-105335211", "type": "article", "title": "Kinetics of Reactions in Gases", "author": [ { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Sowden", "given_name": "Ronald G.", "clpid": "Sowden-R-G" } ], "abstract": "The reviewers have endeavored to consider selected topics in a critical\nfashion. We readily admit that our classification of papers into general topics\nis, to some extent, arbitrary. We further apologize for omission of some\npapers, including several interesting theoretical ones, because of limitations\nof space and of our competence.", "doi": "10.1146/annurev.pc.06.100155.001511", "issn": "0066-426X", "publisher": "Annual Reviews", "publication": "Annual Review of Physical Chemistry", "publication_date": "1955-10", "volume": "6", "pages": "303-326" }, { "id": "authors:0p6jh-mds98", "collection": "authors", "collection_id": "0p6jh-mds98", "cite_using_url": "https://resolver.caltech.edu/CaltechAUTHORS:DAVpr48", "type": "article", "title": "Conductivity pulses in liquid argon", "author": [ { "family_name": "Davidson", "given_name": "Norman", "clpid": "Davidson-N-R" }, { "family_name": "Larsh", "given_name": "A. E., Jr.", "clpid": "Larsh-A-E-Jr" } ], "abstract": "The recent interest in the topic of crystal counters has prompted us to attempt a similar experiment with insulating liquids instead of crystals, in order to investigate whether, in such liquids, ionizing radiations excite electrons into conduction levels in which the electrons can move rapidly in an applied field. The purpose of this preliminary communication is to report that we have observed conductivity pulses due to polonium alpha-particles in liquid argon. No such effect was obtained in liquid nitrogen or in n-heptane at room temperature.", "doi": "10.1103/PhysRev.74.220", "issn": "0031-899X", "publisher": "Physical Review", "publication": "Physical Review", "publication_date": "1948-07-15", "series_number": "2", "volume": "74", "issue": "2", "pages": "220" } ]